Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Ganab'

702454

Institutional Source

Beutler Lab

Gene Symbol

Ganab

Ensembl Gene

ENSMUSG00000071650

Gene Name

alpha glucosidase 2 alpha neutral subunit

Synonyms

G2an, GluII

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8898090-8916663 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8912864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 719 (I719T)

Ref Sequence

ENSEMBL: ENSMUSP00000093965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096246]

AlphaFold

Q8BHN3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096246
AA Change: I719T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: I719T

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
low complexity region	157	169	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	275	346	3.9e-24	PFAM
Pfam:Glyco_hydro_31	387	832	8.7e-136	PFAM
low complexity region	888	898	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tacc2	G	T	7: 130,626,803	K1739N	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Ganab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Ganab	APN	19	8902595	missense	probably benign
IGL00434:Ganab	APN	19	8907343	missense	probably damaging	1.00
IGL01415:Ganab	APN	19	8914694	splice site	probably benign
IGL02418:Ganab	APN	19	8911069	missense	probably null	0.97
IGL02886:Ganab	APN	19	8911027	splice site	probably benign
IGL02997:Ganab	APN	19	8915412	missense	probably benign	0.00
IGL03108:Ganab	APN	19	8912476	missense	probably damaging	1.00
R0240:Ganab	UTSW	19	8912813	missense	possibly damaging	0.58
R0240:Ganab	UTSW	19	8912813	missense	possibly damaging	0.58
R0349:Ganab	UTSW	19	8911652	missense	probably null	0.11
R0457:Ganab	UTSW	19	8907250	missense	possibly damaging	0.92
R0551:Ganab	UTSW	19	8907280	missense	probably benign	0.35
R0645:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R0652:Ganab	UTSW	19	8915402	critical splice acceptor site	probably null
R0688:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R0726:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R1427:Ganab	UTSW	19	8915666	missense	probably benign	0.00
R1946:Ganab	UTSW	19	8910808	missense	probably damaging	1.00
R1955:Ganab	UTSW	19	8911616	nonsense	probably null
R2173:Ganab	UTSW	19	8902260	unclassified	probably benign
R2280:Ganab	UTSW	19	8909468	missense	probably damaging	1.00
R2281:Ganab	UTSW	19	8909468	missense	probably damaging	1.00
R4897:Ganab	UTSW	19	8914991	missense	probably benign	0.07
R5224:Ganab	UTSW	19	8910591	missense	probably benign	0.35
R5269:Ganab	UTSW	19	8911937	missense	probably damaging	1.00
R5323:Ganab	UTSW	19	8908685	missense	probably benign	0.00
R5850:Ganab	UTSW	19	8911707	missense	probably damaging	1.00
R6469:Ganab	UTSW	19	8902632	critical splice donor site	probably null
R6911:Ganab	UTSW	19	8907788	splice site	probably null
R7284:Ganab	UTSW	19	8912540	missense	probably damaging	1.00
R7412:Ganab	UTSW	19	8912528	missense	probably benign	0.01
R7413:Ganab	UTSW	19	8904975	missense	probably benign	0.01
R7466:Ganab	UTSW	19	8914569	nonsense	probably null
R7586:Ganab	UTSW	19	8911352	missense	possibly damaging	0.76
R7657:Ganab	UTSW	19	8907357	missense	probably damaging	0.99
R7671:Ganab	UTSW	19	8912852	missense	possibly damaging	0.94
R7729:Ganab	UTSW	19	8914712	missense	probably benign	0.24
R8223:Ganab	UTSW	19	8910828	missense	probably damaging	1.00
R8873:Ganab	UTSW	19	8910879	nonsense	probably null
R9388:Ganab	UTSW	19	8914938	missense	probably damaging	1.00
R9447:Ganab	UTSW	19	8909530	missense	probably damaging	0.99
R9450:Ganab	UTSW	19	8915712	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATATGAATGGCTGCCAGCGC -3'
(R):5'- TTACAAACAAGGCCCTGGAAAG -3'

Sequencing Primer
(F):5'- TGCCATTTTGCAACCTGC -3'
(R):5'- CCTGGAAAGGGAAAGAAATAGGCC -3'

Posted On

2022-03-25