Incidental Mutation 'R0749:Cyp3a16'
ID70246
Institutional Source Beutler Lab
Gene Symbol Cyp3a16
Ensembl Gene ENSMUSG00000038656
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 16
Synonyms
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145436309-145469723 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 145456177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031633] [ENSMUST00000031633]
Predicted Effect probably null
Transcript: ENSMUST00000031633
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031633
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Cyp3a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Cyp3a16 APN 5 145440434 missense probably damaging 0.98
IGL01964:Cyp3a16 APN 5 145455562 missense probably benign 0.41
IGL02007:Cyp3a16 APN 5 145441948 splice site probably benign
IGL02139:Cyp3a16 APN 5 145455480 missense probably benign 0.10
IGL02177:Cyp3a16 APN 5 145450154 missense probably benign 0.43
IGL02407:Cyp3a16 APN 5 145451842 missense probably damaging 0.99
IGL02473:Cyp3a16 APN 5 145440494 missense possibly damaging 0.54
polywog UTSW 5 145467470 nonsense probably null
R0363:Cyp3a16 UTSW 5 145455879 splice site probably benign
R0556:Cyp3a16 UTSW 5 145455980 missense probably benign 0.37
R0557:Cyp3a16 UTSW 5 145469588 missense unknown
R0636:Cyp3a16 UTSW 5 145463085 missense probably benign 0.03
R0788:Cyp3a16 UTSW 5 145465076 missense probably benign 0.00
R1552:Cyp3a16 UTSW 5 145436536 missense probably benign 0.01
R1575:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R1580:Cyp3a16 UTSW 5 145442074 missense possibly damaging 0.94
R1580:Cyp3a16 UTSW 5 145442075 missense probably damaging 1.00
R1642:Cyp3a16 UTSW 5 145469589 missense unknown
R1763:Cyp3a16 UTSW 5 145465031 critical splice donor site probably null
R2029:Cyp3a16 UTSW 5 145451857 missense probably damaging 0.96
R2144:Cyp3a16 UTSW 5 145456084 missense probably damaging 1.00
R2409:Cyp3a16 UTSW 5 145440367 missense probably benign 0.01
R2473:Cyp3a16 UTSW 5 145455594 missense possibly damaging 0.79
R2860:Cyp3a16 UTSW 5 145455499 nonsense probably null
R2861:Cyp3a16 UTSW 5 145455499 nonsense probably null
R3747:Cyp3a16 UTSW 5 145442071 missense probably damaging 1.00
R4654:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R4781:Cyp3a16 UTSW 5 145456112 missense possibly damaging 0.85
R4873:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4875:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4925:Cyp3a16 UTSW 5 145452834 missense probably benign 0.00
R5365:Cyp3a16 UTSW 5 145452787 missense probably damaging 1.00
R5496:Cyp3a16 UTSW 5 145467531 missense probably damaging 1.00
R5640:Cyp3a16 UTSW 5 145452823 missense possibly damaging 0.94
R5761:Cyp3a16 UTSW 5 145442033 missense possibly damaging 0.79
R6401:Cyp3a16 UTSW 5 145440364 missense probably damaging 1.00
R6526:Cyp3a16 UTSW 5 145455895 missense probably benign 0.01
R6528:Cyp3a16 UTSW 5 145440431 missense probably damaging 1.00
R7000:Cyp3a16 UTSW 5 145463170 critical splice acceptor site probably null
R7268:Cyp3a16 UTSW 5 145467470 nonsense probably null
R7630:Cyp3a16 UTSW 5 145436310 splice site probably null
Predicted Primers PCR Primer
(F):5'- GATGGACCAGCACTCACTCTTTCAC -3'
(R):5'- CCCCTGGACCTAGTTTTCCAACAAC -3'

Sequencing Primer
(F):5'- GTCTCCATACTGTTCAATGACAGG -3'
(R):5'- TCATAGGCTGTGAGGCATTC -3'
Posted On2013-09-30