Incidental Mutation 'R0749:Cpt1c'
ID70248
Institutional Source Beutler Lab
Gene Symbol Cpt1c
Ensembl Gene ENSMUSG00000007783
Gene Namecarnitine palmitoyltransferase 1c
Synonyms9630004I06Rik, CPT I-C
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44959372-44974851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44962826 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 494 (Y494H)
Ref Sequence ENSEMBL: ENSMUSP00000148815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063761] [ENSMUST00000080233] [ENSMUST00000120929] [ENSMUST00000211862] [ENSMUST00000212836]
Predicted Effect probably damaging
Transcript: ENSMUST00000063761
AA Change: Y494H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783
AA Change: Y494H

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080233
SMART Domains Protein: ENSMUSP00000079122
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 525 5.7e-281 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120929
SMART Domains Protein: ENSMUSP00000112673
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 585 8.1e-297 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208475
Predicted Effect probably benign
Transcript: ENSMUST00000211862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212217
Predicted Effect probably damaging
Transcript: ENSMUST00000212836
AA Change: Y494H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212890
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein regulates the beta-oxidation and transport of long-chain fatty acids into mitochondria, and may play a role in the regulation of feeding behavior and whole-body energy homeostasis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted mutations in this gene result in reduced body weight, increases in circulating fatty acid levels and mild insulin resistance. Mice homozygous for a different targeted knock-out exhibit reduced ceramide levels, impaired dendritic spine maturationand impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Cpt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Cpt1c APN 7 44960909 missense probably damaging 0.98
IGL01111:Cpt1c APN 7 44965554 missense possibly damaging 0.90
IGL01153:Cpt1c APN 7 44966668 missense probably damaging 0.99
IGL02232:Cpt1c APN 7 44960156 missense probably damaging 0.99
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0141:Cpt1c UTSW 7 44966671 missense probably damaging 1.00
R0367:Cpt1c UTSW 7 44959575 missense probably benign
R1384:Cpt1c UTSW 7 44960924 splice site probably benign
R1611:Cpt1c UTSW 7 44960112 missense probably benign 0.03
R3122:Cpt1c UTSW 7 44959921 missense probably damaging 1.00
R4892:Cpt1c UTSW 7 44959588 missense probably benign 0.14
R5175:Cpt1c UTSW 7 44971357 missense probably damaging 1.00
R6029:Cpt1c UTSW 7 44965124 missense probably benign 0.00
R6352:Cpt1c UTSW 7 44966795 critical splice donor site probably null
R6856:Cpt1c UTSW 7 44959918 missense probably damaging 1.00
R7621:Cpt1c UTSW 7 44967092 missense probably damaging 1.00
R7749:Cpt1c UTSW 7 44962265 missense probably benign 0.16
R7966:Cpt1c UTSW 7 44964014 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGCAAGCAGGCTCGTAGAGGTTC -3'
(R):5'- ACCAAAATGGGTTCCAGGGCAG -3'

Sequencing Primer
(F):5'- CTAGTCAGGGACTCTAGGCAG -3'
(R):5'- TGAGCCCAGAAGGCTAAGC -3'
Posted On2013-09-30