Mutagenetix > Incidental Mutations

Incidental Mutation 'R9265:Csf2rb'

702494

Institutional Source

Beutler Lab

Gene Symbol

Csf2rb

Ensembl Gene

ENSMUSG00000071713

Gene Name

colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

Synonyms

Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131

Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9265 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78325752-78353847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78348546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 684 (E684D)

Ref Sequence

ENSEMBL: ENSMUSP00000094082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264]

AlphaFold

P26955

Predicted Effect

probably benign
Transcript: ENSMUST00000096355
AA Change: E684D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: E684D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SCOP:d1gh7a1	29	130	6e-58	SMART
FN3	136	224	4.44e0	SMART
Blast:FN3	245	338	3e-24	BLAST
SCOP:d1gh7a3	245	338	2e-45	SMART
FN3	343	426	2.41e0	SMART
transmembrane domain	446	468	N/A	INTRINSIC
low complexity region	716	743	N/A	INTRINSIC
low complexity region	824	845	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229678

Predicted Effect

probably benign
Transcript: ENSMUST00000230264
AA Change: E684D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a2	T	C	11: 61,262,268	K211E	probably damaging	Het
Apba2	G	T	7: 64,743,272	A514S	probably damaging	Het
Aspm	C	T	1: 139,461,444	T615I	probably benign	Het
Atrnl1	T	A	19: 57,777,927	F1232Y	probably benign	Het
B4galt3	A	G	1: 171,274,047	D197G	probably damaging	Het
Calcrl	T	G	2: 84,370,056	N127H	possibly damaging	Het
Camkv	T	G	9: 107,948,063	I421S	possibly damaging	Het
Cdc123	T	C	2: 5,803,954	D237G	possibly damaging	Het
Cilp	A	G	9: 65,280,051	T1143A	probably benign	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cpn1	T	C	19: 43,970,160	I201V	probably damaging	Het
Cr1l	T	C	1: 195,123,719	D152G	probably benign	Het
Csmd2	A	T	4: 128,400,370	N1164I		Het
Ddx42	A	G	11: 106,241,609	N486S	probably benign	Het
Dnah6	A	G	6: 73,083,057	I2848T	probably benign	Het
Dnah7a	T	C	1: 53,635,346	D424G	probably benign	Het
Dnah9	T	C	11: 65,841,255	H4275R	probably benign	Het
Epha6	G	A	16: 59,655,754	T1083M	probably damaging	Het
Fzd1	A	G	5: 4,757,216	I122T	probably damaging	Het
Gm28042	T	C	2: 120,041,224	F914S	probably damaging	Het
Gpatch11	A	G	17: 78,839,118	D64G	probably benign	Het
Hinfp	A	G	9: 44,297,786	V345A	possibly damaging	Het
Hoxd8	C	T	2: 74,705,771	S75L	probably benign	Het
Igsf1	A	G	X: 49,795,314	M2T	possibly damaging	Het
Krt42	C	T	11: 100,266,982	E219K	probably damaging	Het
Mcm3	C	A	1: 20,809,681	D531Y	probably damaging	Het
Mid1	C	G	X: 169,985,007	P384A	probably benign	Het
Msantd1	C	T	5: 34,923,517	R264*	probably null	Het
Nadk2	A	G	15: 9,071,694	T65A	probably damaging	Het
Nbea	AC	A	3: 56,090,972		probably null	Het
Neb	T	C	2: 52,199,444	D5172G	probably null	Het
Nlrp9a	G	T	7: 26,558,613	R552I	possibly damaging	Het
Nr3c2	A	G	8: 76,909,607	T446A	probably benign	Het
Olfr1265	T	C	2: 90,037,498	I193T	probably benign	Het
Olfr577	C	T	7: 102,973,905	W29*	probably null	Het
Olfr605	C	A	7: 103,442,958	R55L	possibly damaging	Het
Olfr836	T	A	9: 19,121,688	C241*	probably null	Het
Pcdhb10	A	G	18: 37,413,500	Q543R	possibly damaging	Het
Pcdhga6	A	G	18: 37,708,049	H274R	possibly damaging	Het
Pknox1	A	G	17: 31,590,698	D92G	probably damaging	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Rlf	G	C	4: 121,150,290	P608A	possibly damaging	Het
Sardh	A	T	2: 27,215,053	I686N	probably damaging	Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
St6gal1	A	G	16: 23,321,418	Y113C	probably damaging	Het
Syndig1	T	C	2: 150,003,240	F228L	probably damaging	Het
Ttll5	T	A	12: 85,891,021	C375*	probably null	Het
Zscan4c	T	A	7: 11,006,897	S114R	probably benign	Het

Other mutations in Csf2rb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Csf2rb	APN	15	78348514	nonsense	probably null
IGL00979:Csf2rb	APN	15	78348104	missense	probably damaging	1.00
IGL01613:Csf2rb	APN	15	78335302	intron	probably benign
IGL01724:Csf2rb	APN	15	78336414	missense	probably damaging	1.00
IGL01942:Csf2rb	APN	15	78340492	missense	probably benign
IGL02479:Csf2rb	APN	15	78341724	nonsense	probably null
3-1:Csf2rb	UTSW	15	78344603	missense	probably damaging	1.00
IGL02802:Csf2rb	UTSW	15	78338903	missense	probably benign	0.00
R0133:Csf2rb	UTSW	15	78339004	unclassified	probably benign
R0179:Csf2rb	UTSW	15	78336372	missense	possibly damaging	0.52
R0487:Csf2rb	UTSW	15	78348331	missense	probably benign	0.00
R1544:Csf2rb	UTSW	15	78340755	missense	probably benign	0.02
R1619:Csf2rb	UTSW	15	78335211	missense	probably damaging	0.99
R1690:Csf2rb	UTSW	15	78348644	missense	probably benign	0.11
R1831:Csf2rb	UTSW	15	78348253	missense	probably benign	0.03
R3970:Csf2rb	UTSW	15	78341467	missense	probably benign
R4922:Csf2rb	UTSW	15	78346467	missense	probably benign	0.02
R5151:Csf2rb	UTSW	15	78340581	missense	probably damaging	1.00
R5202:Csf2rb	UTSW	15	78349057	missense	possibly damaging	0.51
R5398:Csf2rb	UTSW	15	78348620	missense	probably benign
R5496:Csf2rb	UTSW	15	78340561	missense	probably damaging	1.00
R5786:Csf2rb	UTSW	15	78348955	missense	probably damaging	1.00
R6166:Csf2rb	UTSW	15	78344566	missense	probably damaging	1.00
R6347:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6350:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6899:Csf2rb	UTSW	15	78340702	missense	probably benign	0.01
R6984:Csf2rb	UTSW	15	78345519	missense	probably damaging	1.00
R7484:Csf2rb	UTSW	15	78338899	missense	possibly damaging	0.53
R7671:Csf2rb	UTSW	15	78338930	missense	probably damaging	1.00
R7751:Csf2rb	UTSW	15	78341639	missense	probably damaging	1.00
R7781:Csf2rb	UTSW	15	78344571	missense	probably benign	0.00
R7861:Csf2rb	UTSW	15	78349157	missense	probably damaging	1.00
R8135:Csf2rb	UTSW	15	78348119	missense	possibly damaging	0.95
R8154:Csf2rb	UTSW	15	78340442	critical splice acceptor site	probably null
R8299:Csf2rb	UTSW	15	78346469	missense	possibly damaging	0.88
R8315:Csf2rb	UTSW	15	78347381	missense	possibly damaging	0.83
R8926:Csf2rb	UTSW	15	78340549	missense	probably benign
R8948:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R8950:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
X0024:Csf2rb	UTSW	15	78336360	missense	probably damaging	1.00
X0028:Csf2rb	UTSW	15	78349002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGGAGTACATGTGTCTGCCC -3'
(R):5'- ATAGTCCTCAAACCCTGGTGG -3'

Sequencing Primer
(F):5'- GTACATGTGTCTGCCCCCTGG -3'
(R):5'- ACCCTGGGCAGCTTAAGACAG -3'

Posted On

2022-03-25