Incidental Mutation 'R9265:Csf2rb'
ID 702494
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9265 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78348546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 684 (E684D)
Ref Sequence ENSEMBL: ENSMUSP00000094082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264]
AlphaFold P26955
Predicted Effect probably benign
Transcript: ENSMUST00000096355
AA Change: E684D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: E684D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229678
Predicted Effect probably benign
Transcript: ENSMUST00000230264
AA Change: E684D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a2 T C 11: 61,262,268 K211E probably damaging Het
Apba2 G T 7: 64,743,272 A514S probably damaging Het
Aspm C T 1: 139,461,444 T615I probably benign Het
Atrnl1 T A 19: 57,777,927 F1232Y probably benign Het
B4galt3 A G 1: 171,274,047 D197G probably damaging Het
Calcrl T G 2: 84,370,056 N127H possibly damaging Het
Camkv T G 9: 107,948,063 I421S possibly damaging Het
Cdc123 T C 2: 5,803,954 D237G possibly damaging Het
Cilp A G 9: 65,280,051 T1143A probably benign Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cpn1 T C 19: 43,970,160 I201V probably damaging Het
Cr1l T C 1: 195,123,719 D152G probably benign Het
Csmd2 A T 4: 128,400,370 N1164I Het
Ddx42 A G 11: 106,241,609 N486S probably benign Het
Dnah6 A G 6: 73,083,057 I2848T probably benign Het
Dnah7a T C 1: 53,635,346 D424G probably benign Het
Dnah9 T C 11: 65,841,255 H4275R probably benign Het
Epha6 G A 16: 59,655,754 T1083M probably damaging Het
Fzd1 A G 5: 4,757,216 I122T probably damaging Het
Gm28042 T C 2: 120,041,224 F914S probably damaging Het
Gpatch11 A G 17: 78,839,118 D64G probably benign Het
Hinfp A G 9: 44,297,786 V345A possibly damaging Het
Hoxd8 C T 2: 74,705,771 S75L probably benign Het
Igsf1 A G X: 49,795,314 M2T possibly damaging Het
Krt42 C T 11: 100,266,982 E219K probably damaging Het
Mcm3 C A 1: 20,809,681 D531Y probably damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Msantd1 C T 5: 34,923,517 R264* probably null Het
Nadk2 A G 15: 9,071,694 T65A probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Nlrp9a G T 7: 26,558,613 R552I possibly damaging Het
Nr3c2 A G 8: 76,909,607 T446A probably benign Het
Olfr1265 T C 2: 90,037,498 I193T probably benign Het
Olfr577 C T 7: 102,973,905 W29* probably null Het
Olfr605 C A 7: 103,442,958 R55L possibly damaging Het
Olfr836 T A 9: 19,121,688 C241* probably null Het
Pcdhb10 A G 18: 37,413,500 Q543R possibly damaging Het
Pcdhga6 A G 18: 37,708,049 H274R possibly damaging Het
Pknox1 A G 17: 31,590,698 D92G probably damaging Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Rlf G C 4: 121,150,290 P608A possibly damaging Het
Sardh A T 2: 27,215,053 I686N probably damaging Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
St6gal1 A G 16: 23,321,418 Y113C probably damaging Het
Syndig1 T C 2: 150,003,240 F228L probably damaging Het
Ttll5 T A 12: 85,891,021 C375* probably null Het
Zscan4c T A 7: 11,006,897 S114R probably benign Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAGTACATGTGTCTGCCC -3'
(R):5'- ATAGTCCTCAAACCCTGGTGG -3'

Sequencing Primer
(F):5'- GTACATGTGTCTGCCCCCTGG -3'
(R):5'- ACCCTGGGCAGCTTAAGACAG -3'
Posted On 2022-03-25