Mutagenetix > Incidental Mutation

Incidental Mutation 'R9265:Sstr3'

702495

Institutional Source

Beutler Lab

Gene Symbol

Sstr3

Ensembl Gene

ENSMUSG00000044933

Gene Name

somatostatin receptor 3

Synonyms

Smstr-3, Smstr3, sst3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9265 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78421208-78428885 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 78423792 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 318 (N318K)

Ref Sequence

ENSEMBL: ENSMUSP00000058040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]

AlphaFold

P30935

Predicted Effect

probably damaging
Transcript: ENSMUST00000053239
AA Change: N318K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: N318K

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	53	291	1.9e-8	PFAM
Pfam:7TM_GPCR_Srsx	56	337	3.5e-15	PFAM
Pfam:7tm_1	62	322	6.3e-60	PFAM
Pfam:7TM_GPCR_Srv	121	337	9.5e-8	PFAM
coiled coil region	355	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000230400

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a2	T	C	11: 61,153,094 (GRCm39)	K211E	probably damaging	Het
Apba2	G	T	7: 64,393,020 (GRCm39)	A514S	probably damaging	Het
Aspm	C	T	1: 139,389,182 (GRCm39)	T615I	probably benign	Het
Atrnl1	T	A	19: 57,766,359 (GRCm39)	F1232Y	probably benign	Het
B4galt3	A	G	1: 171,101,617 (GRCm39)	D197G	probably damaging	Het
Calcrl	T	G	2: 84,200,400 (GRCm39)	N127H	possibly damaging	Het
Camkv	T	G	9: 107,825,262 (GRCm39)	I421S	possibly damaging	Het
Cdc123	T	C	2: 5,808,765 (GRCm39)	D237G	possibly damaging	Het
Cilp	A	G	9: 65,187,333 (GRCm39)	T1143A	probably benign	Het
Col5a1	G	A	2: 27,854,123 (GRCm39)	R569K	unknown	Het
Cpn1	T	C	19: 43,958,599 (GRCm39)	I201V	probably damaging	Het
Cr1l	T	C	1: 194,806,027 (GRCm39)	D152G	probably benign	Het
Csf2rb	A	T	15: 78,232,746 (GRCm39)	E684D	probably benign	Het
Csmd2	A	T	4: 128,294,163 (GRCm39)	N1164I		Het
Ddx42	A	G	11: 106,132,435 (GRCm39)	N486S	probably benign	Het
Dnah6	A	G	6: 73,060,040 (GRCm39)	I2848T	probably benign	Het
Dnah7a	T	C	1: 53,674,505 (GRCm39)	D424G	probably benign	Het
Dnah9	T	C	11: 65,732,081 (GRCm39)	H4275R	probably benign	Het
Epha6	G	A	16: 59,476,117 (GRCm39)	T1083M	probably damaging	Het
Fzd1	A	G	5: 4,807,216 (GRCm39)	I122T	probably damaging	Het
Gm28042	T	C	2: 119,871,705 (GRCm39)	F914S	probably damaging	Het
Gpatch11	A	G	17: 79,146,547 (GRCm39)	D64G	probably benign	Het
Hinfp	A	G	9: 44,209,083 (GRCm39)	V345A	possibly damaging	Het
Hoxd8	C	T	2: 74,536,115 (GRCm39)	S75L	probably benign	Het
Igsf1	A	G	X: 48,884,191 (GRCm39)	M2T	possibly damaging	Het
Krt42	C	T	11: 100,157,808 (GRCm39)	E219K	probably damaging	Het
Mcm3	C	A	1: 20,879,905 (GRCm39)	D531Y	probably damaging	Het
Msantd1	C	T	5: 35,080,861 (GRCm39)	R264*	probably null	Het
Nadk2	A	G	15: 9,071,774 (GRCm39)	T65A	probably damaging	Het
Nbea	AC	A	3: 55,998,393 (GRCm39)		probably null	Het
Neb	T	C	2: 52,089,456 (GRCm39)	D5172G	probably null	Het
Nlrp9a	G	T	7: 26,258,038 (GRCm39)	R552I	possibly damaging	Het
Nr3c2	A	G	8: 77,636,236 (GRCm39)	T446A	probably benign	Het
Or4x11	T	C	2: 89,867,842 (GRCm39)	I193T	probably benign	Het
Or51g2	C	T	7: 102,623,112 (GRCm39)	W29*	probably null	Het
Or52s6	C	A	7: 103,092,165 (GRCm39)	R55L	possibly damaging	Het
Or7g21	T	A	9: 19,032,984 (GRCm39)	C241*	probably null	Het
Pcdhb10	A	G	18: 37,546,553 (GRCm39)	Q543R	possibly damaging	Het
Pcdhga6	A	G	18: 37,841,102 (GRCm39)	H274R	possibly damaging	Het
Pknox1	A	G	17: 31,809,672 (GRCm39)	D92G	probably damaging	Het
Pnpla6	C	T	8: 3,573,294 (GRCm39)	P386L	probably benign	Het
Rlf	G	C	4: 121,007,487 (GRCm39)	P608A	possibly damaging	Het
Sardh	A	T	2: 27,105,065 (GRCm39)	I686N	probably damaging	Het
St6gal1	A	G	16: 23,140,168 (GRCm39)	Y113C	probably damaging	Het
Syndig1	T	C	2: 149,845,160 (GRCm39)	F228L	probably damaging	Het
Ttll5	T	A	12: 85,937,795 (GRCm39)	C375*	probably null	Het
Zscan4c	T	A	7: 10,740,824 (GRCm39)	S114R	probably benign	Het

Other mutations in Sstr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sstr3	APN	15	78,424,667 (GRCm39)	missense	probably benign	0.00
R0442:Sstr3	UTSW	15	78,424,597 (GRCm39)	missense	probably damaging	0.99
R1714:Sstr3	UTSW	15	78,424,473 (GRCm39)	missense	probably damaging	1.00
R1865:Sstr3	UTSW	15	78,424,168 (GRCm39)	missense	probably damaging	1.00
R2008:Sstr3	UTSW	15	78,424,711 (GRCm39)	missense	probably benign	0.14
R2351:Sstr3	UTSW	15	78,424,121 (GRCm39)	missense	probably benign	0.01
R3023:Sstr3	UTSW	15	78,424,187 (GRCm39)	missense	probably damaging	0.99
R3024:Sstr3	UTSW	15	78,424,187 (GRCm39)	missense	probably damaging	0.99
R3770:Sstr3	UTSW	15	78,424,577 (GRCm39)	missense	probably damaging	1.00
R4399:Sstr3	UTSW	15	78,424,324 (GRCm39)	missense	probably damaging	1.00
R4724:Sstr3	UTSW	15	78,423,897 (GRCm39)	nonsense	probably null
R6181:Sstr3	UTSW	15	78,423,661 (GRCm39)	missense	probably benign
R6247:Sstr3	UTSW	15	78,423,788 (GRCm39)	missense	probably damaging	0.99
R7450:Sstr3	UTSW	15	78,424,043 (GRCm39)	missense	probably damaging	1.00
R7578:Sstr3	UTSW	15	78,424,717 (GRCm39)	missense	probably benign
R7793:Sstr3	UTSW	15	78,424,588 (GRCm39)	missense	probably damaging	1.00
R8336:Sstr3	UTSW	15	78,424,693 (GRCm39)	missense	probably damaging	1.00
R9263:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
R9264:Sstr3	UTSW	15	78,423,792 (GRCm39)	missense	probably damaging	1.00
X0026:Sstr3	UTSW	15	78,423,574 (GRCm39)	missense	possibly damaging	0.57
Z1177:Sstr3	UTSW	15	78,423,503 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTGTTGTCCACTAGTGC -3'
(R):5'- GCTCATTGTGGTAAAGGTGC -3'

Sequencing Primer
(F):5'- TGTGCGATCTGACTGAGCCTC -3'
(R):5'- TAAAGGTGCGGTCGACCAC -3'

Posted On

2022-03-25