Incidental Mutation 'R9265:Epha6'
ID 702497
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9265 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59655754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1083 (T1083M)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: T1083M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: T1083M

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a2 T C 11: 61,262,268 K211E probably damaging Het
Apba2 G T 7: 64,743,272 A514S probably damaging Het
Aspm C T 1: 139,461,444 T615I probably benign Het
Atrnl1 T A 19: 57,777,927 F1232Y probably benign Het
B4galt3 A G 1: 171,274,047 D197G probably damaging Het
Calcrl T G 2: 84,370,056 N127H possibly damaging Het
Camkv T G 9: 107,948,063 I421S possibly damaging Het
Cdc123 T C 2: 5,803,954 D237G possibly damaging Het
Cilp A G 9: 65,280,051 T1143A probably benign Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cpn1 T C 19: 43,970,160 I201V probably damaging Het
Cr1l T C 1: 195,123,719 D152G probably benign Het
Csf2rb A T 15: 78,348,546 E684D probably benign Het
Csmd2 A T 4: 128,400,370 N1164I Het
Ddx42 A G 11: 106,241,609 N486S probably benign Het
Dnah6 A G 6: 73,083,057 I2848T probably benign Het
Dnah7a T C 1: 53,635,346 D424G probably benign Het
Dnah9 T C 11: 65,841,255 H4275R probably benign Het
Fzd1 A G 5: 4,757,216 I122T probably damaging Het
Gm28042 T C 2: 120,041,224 F914S probably damaging Het
Gpatch11 A G 17: 78,839,118 D64G probably benign Het
Hinfp A G 9: 44,297,786 V345A possibly damaging Het
Hoxd8 C T 2: 74,705,771 S75L probably benign Het
Igsf1 A G X: 49,795,314 M2T possibly damaging Het
Krt42 C T 11: 100,266,982 E219K probably damaging Het
Mcm3 C A 1: 20,809,681 D531Y probably damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Msantd1 C T 5: 34,923,517 R264* probably null Het
Nadk2 A G 15: 9,071,694 T65A probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Nlrp9a G T 7: 26,558,613 R552I possibly damaging Het
Nr3c2 A G 8: 76,909,607 T446A probably benign Het
Olfr1265 T C 2: 90,037,498 I193T probably benign Het
Olfr577 C T 7: 102,973,905 W29* probably null Het
Olfr605 C A 7: 103,442,958 R55L possibly damaging Het
Olfr836 T A 9: 19,121,688 C241* probably null Het
Pcdhb10 A G 18: 37,413,500 Q543R possibly damaging Het
Pcdhga6 A G 18: 37,708,049 H274R possibly damaging Het
Pknox1 A G 17: 31,590,698 D92G probably damaging Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Rlf G C 4: 121,150,290 P608A possibly damaging Het
Sardh A T 2: 27,215,053 I686N probably damaging Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
St6gal1 A G 16: 23,321,418 Y113C probably damaging Het
Syndig1 T C 2: 150,003,240 F228L probably damaging Het
Ttll5 T A 12: 85,891,021 C375* probably null Het
Zscan4c T A 7: 11,006,897 S114R probably benign Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
R9442:Epha6 UTSW 16 60205487 missense probably benign 0.26
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGCTTCCACCAGAATG -3'
(R):5'- TCTCAGAGTGCTTGCATAGAC -3'

Sequencing Primer
(F):5'- GCTTCCACCAGAATGATAATCAGG -3'
(R):5'- GAGTGCTTGCATAGACTTTAAAAAGG -3'
Posted On 2022-03-25