Incidental Mutation 'R0749:Hmgxb4'
ID70250
Institutional Source Beutler Lab
Gene Symbol Hmgxb4
Ensembl Gene ENSMUSG00000034518
Gene NameHMG box domain containing 4
SynonymsHmgb2l1, 4733401K04Rik
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location74993356-75031978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75000937 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000045126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041759] [ENSMUST00000145919] [ENSMUST00000211863]
Predicted Effect probably damaging
Transcript: ENSMUST00000041759
AA Change: T183A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045126
Gene: ENSMUSG00000034518
AA Change: T183A

DomainStartEndE-ValueType
low complexity region 53 63 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
Pfam:DUF4171 107 232 1.3e-55 PFAM
low complexity region 250 261 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
HMG 399 469 7.63e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134126
Predicted Effect probably benign
Transcript: ENSMUST00000145919
SMART Domains Protein: ENSMUSP00000133586
Gene: ENSMUSG00000034518

DomainStartEndE-ValueType
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151062
Predicted Effect probably benign
Transcript: ENSMUST00000211863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212372
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] High mobility group (HMG) proteins are nonhistone chromosomal proteins. See HMG2 (MIM 163906) for additional information on HMG proteins.[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Hmgxb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Hmgxb4 APN 8 75029503 missense probably damaging 1.00
IGL00515:Hmgxb4 APN 8 75000911 missense probably damaging 1.00
IGL02337:Hmgxb4 APN 8 74999631 missense probably damaging 1.00
IGL03281:Hmgxb4 APN 8 75024162 missense probably damaging 1.00
golightly UTSW 8 75029996 missense probably damaging 1.00
R0324:Hmgxb4 UTSW 8 74998928 missense probably benign 0.00
R5862:Hmgxb4 UTSW 8 75001055 missense probably damaging 1.00
R5910:Hmgxb4 UTSW 8 74999565 missense probably benign 0.21
R6190:Hmgxb4 UTSW 8 75023299 missense probably benign 0.00
R6307:Hmgxb4 UTSW 8 75023299 missense possibly damaging 0.51
R7031:Hmgxb4 UTSW 8 75029572 nonsense probably null
R7171:Hmgxb4 UTSW 8 75020262 missense probably damaging 1.00
R7197:Hmgxb4 UTSW 8 75029996 missense probably damaging 1.00
R7765:Hmgxb4 UTSW 8 75000808 missense probably damaging 0.97
R7820:Hmgxb4 UTSW 8 75000946 nonsense probably null
R7997:Hmgxb4 UTSW 8 75001328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAAAGCTATCACCTCCCCACTG -3'
(R):5'- CTGAGGATGACTTGTGCTTCTTCCG -3'

Sequencing Primer
(F):5'- GGGTGCCAAGTCCTCTAAG -3'
(R):5'- TCAGGAGGCTCTGTAGCTC -3'
Posted On2013-09-30