Incidental Mutation 'R9265:Atrnl1'
ID 702503
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Name attractin like 1
Synonyms Alp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R9265 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 57611034-58133338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57777927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1232 (F1232Y)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
AlphaFold Q6A051
Predicted Effect probably benign
Transcript: ENSMUST00000077282
AA Change: F1232Y

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: F1232Y

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a2 T C 11: 61,262,268 K211E probably damaging Het
Apba2 G T 7: 64,743,272 A514S probably damaging Het
Aspm C T 1: 139,461,444 T615I probably benign Het
B4galt3 A G 1: 171,274,047 D197G probably damaging Het
Calcrl T G 2: 84,370,056 N127H possibly damaging Het
Camkv T G 9: 107,948,063 I421S possibly damaging Het
Cdc123 T C 2: 5,803,954 D237G possibly damaging Het
Cilp A G 9: 65,280,051 T1143A probably benign Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cpn1 T C 19: 43,970,160 I201V probably damaging Het
Cr1l T C 1: 195,123,719 D152G probably benign Het
Csf2rb A T 15: 78,348,546 E684D probably benign Het
Csmd2 A T 4: 128,400,370 N1164I Het
Ddx42 A G 11: 106,241,609 N486S probably benign Het
Dnah6 A G 6: 73,083,057 I2848T probably benign Het
Dnah7a T C 1: 53,635,346 D424G probably benign Het
Dnah9 T C 11: 65,841,255 H4275R probably benign Het
Epha6 G A 16: 59,655,754 T1083M probably damaging Het
Fzd1 A G 5: 4,757,216 I122T probably damaging Het
Gm28042 T C 2: 120,041,224 F914S probably damaging Het
Gpatch11 A G 17: 78,839,118 D64G probably benign Het
Hinfp A G 9: 44,297,786 V345A possibly damaging Het
Hoxd8 C T 2: 74,705,771 S75L probably benign Het
Igsf1 A G X: 49,795,314 M2T possibly damaging Het
Krt42 C T 11: 100,266,982 E219K probably damaging Het
Mcm3 C A 1: 20,809,681 D531Y probably damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Msantd1 C T 5: 34,923,517 R264* probably null Het
Nadk2 A G 15: 9,071,694 T65A probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Nlrp9a G T 7: 26,558,613 R552I possibly damaging Het
Nr3c2 A G 8: 76,909,607 T446A probably benign Het
Olfr1265 T C 2: 90,037,498 I193T probably benign Het
Olfr577 C T 7: 102,973,905 W29* probably null Het
Olfr605 C A 7: 103,442,958 R55L possibly damaging Het
Olfr836 T A 9: 19,121,688 C241* probably null Het
Pcdhb10 A G 18: 37,413,500 Q543R possibly damaging Het
Pcdhga6 A G 18: 37,708,049 H274R possibly damaging Het
Pknox1 A G 17: 31,590,698 D92G probably damaging Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Rlf G C 4: 121,150,290 P608A possibly damaging Het
Sardh A T 2: 27,215,053 I686N probably damaging Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
St6gal1 A G 16: 23,321,418 Y113C probably damaging Het
Syndig1 T C 2: 150,003,240 F228L probably damaging Het
Ttll5 T A 12: 85,891,021 C375* probably null Het
Zscan4c T A 7: 11,006,897 S114R probably benign Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57630292 nonsense probably null
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57654961 missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57642424 missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7726:Atrnl1 UTSW 19 57702072 missense probably damaging 1.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446 missense probably benign 0.14
R8119:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R9242:Atrnl1 UTSW 19 57657228 missense probably benign 0.07
R9272:Atrnl1 UTSW 19 57654988 missense probably benign 0.00
R9480:Atrnl1 UTSW 19 57701988 missense possibly damaging 0.61
R9526:Atrnl1 UTSW 19 57629119 missense probably damaging 0.99
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTGTGCTTACGTCTTAATGT -3'
(R):5'- ACATGCACATACTCAGAGAGACA -3'

Sequencing Primer
(F):5'- TGTGCTTACGTCTTAATGTTTTCAG -3'
(R):5'- TGCACATACTCAGAGAGACATAAAC -3'
Posted On 2022-03-25