Incidental Mutation 'R9266:1600015I10Rik'
ID 702541
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9266 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48930237 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 57 (N57S)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably benign
Transcript: ENSMUST00000031837
AA Change: N57S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: N57S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A G 13: 34,932,586 K106R possibly damaging Het
Abcf1 C A 17: 35,959,286 E627* probably null Het
Arhgap42 A G 9: 9,006,385 V670A probably benign Het
Arhgef16 C A 4: 154,291,465 R24L probably benign Het
Atad2 A T 15: 58,122,571 D251E probably benign Het
Atf2 T C 2: 73,818,927 S447G probably benign Het
Atp8b1 T C 18: 64,571,037 M337V probably benign Het
Atp8b1 C T 18: 64,577,457 D170N possibly damaging Het
Azin2 C A 4: 128,962,437 probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Cdh19 A G 1: 110,890,041 L657P probably damaging Het
Crybg3 A T 16: 59,552,181 V598E probably damaging Het
Cwc22 A G 2: 77,924,608 I208T probably benign Het
Cyp4a32 T A 4: 115,611,110 D292E probably damaging Het
Dnah10 G A 5: 124,768,926 V1510I probably benign Het
Dpp3 G T 19: 4,914,658 Y540* probably null Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Elf1 A G 14: 79,560,850 D59G probably benign Het
Epc1 A T 18: 6,449,219 M476K probably benign Het
Espnl C A 1: 91,345,049 S710R probably benign Het
Fam171b T C 2: 83,853,582 W148R probably damaging Het
Fhod1 A G 8: 105,338,899 L88P unknown Het
Frmd4a A G 2: 4,606,035 S999G probably damaging Het
Glmp T C 3: 88,325,729 I58T probably damaging Het
Gm45861 T A 8: 27,584,646 D1341E unknown Het
Gpr179 A G 11: 97,336,940 I1463T probably benign Het
Gsdmc2 T C 15: 63,826,239 E339G probably damaging Het
Insm1 A T 2: 146,223,013 I250F probably damaging Het
Insm1 G A 2: 146,223,023 G253D possibly damaging Het
Itih1 A T 14: 30,930,265 S824T probably damaging Het
Lactb A G 9: 66,971,217 Y190H possibly damaging Het
Lrba T C 3: 86,291,467 M197T probably benign Het
Lrrc4c A G 2: 97,629,508 I160V probably benign Het
Lrrc59 A T 11: 94,641,218 probably null Het
Ltk A T 2: 119,754,640 M425K possibly damaging Het
Map9 T C 3: 82,371,287 V198A possibly damaging Het
Mms22l T C 4: 24,578,878 Y746H probably damaging Het
Mpp6 T C 6: 50,163,483 M161T probably benign Het
Ms4a4b A G 19: 11,454,696 I60M probably benign Het
Mtif2 T C 11: 29,530,065 W44R probably benign Het
Nadsyn1 A T 7: 143,815,611 W128R probably damaging Het
Nrcam G A 12: 44,590,134 A1117T probably damaging Het
Ntng1 G A 3: 110,143,607 probably benign Het
Ntng1 A G 3: 110,143,846 F56L unknown Het
Oas2 A T 5: 120,749,572 Y68N probably damaging Het
Olfr1224-ps1 A T 2: 89,156,510 F222I possibly damaging Het
Olfr1453 A C 19: 13,028,284 L15R probably damaging Het
Olfr804 T C 10: 129,705,678 S267P probably benign Het
Paqr8 C T 1: 20,935,639 T339I probably benign Het
Pcdhga10 A G 18: 37,748,761 E525G probably benign Het
Psg28 T G 7: 18,427,827 L250F probably benign Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Slc16a4 A T 3: 107,292,472 T12S probably benign Het
Slc9b1 A G 3: 135,348,707 probably benign Het
Slit3 T C 11: 35,707,981 S1471P probably damaging Het
Smpdl3a T C 10: 57,802,500 V133A possibly damaging Het
Snap23 C T 2: 120,584,300 probably benign Het
Spp2 A G 1: 88,417,253 M146V probably benign Het
Syf2 C A 4: 134,936,010 N164K possibly damaging Het
Sync T G 4: 129,293,386 Y70* probably null Het
Tmigd3 T C 3: 105,916,900 F62L probably benign Het
Trpa1 C T 1: 14,910,729 probably null Het
U2surp A T 9: 95,484,415 I480N probably damaging Het
Usf3 C T 16: 44,219,732 T1525I probably damaging Het
Vmn2r2 T C 3: 64,116,636 I841M probably damaging Het
Zfp335 T A 2: 164,896,087 Q868L probably benign Het
Zscan10 A G 17: 23,609,411 E309G possibly damaging Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
R9562:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
R9565:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCTTTGTTCCAGAGCCATGG -3'
(R):5'- AGATTGGTAATGGCATGGGC -3'

Sequencing Primer
(F):5'- TTCCAGAGCCATGGGGATG -3'
(R):5'- CAGCAAACTCAGTGACTTTAGGATGC -3'
Posted On 2022-03-25