Incidental Mutation 'R9267:Galnt5'
ID 702588
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Name polypeptide N-acetylgalactosaminyltransferase 5
Synonyms ppGaNTase-T5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 57997884-58045860 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58035208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 834 (F834L)
Ref Sequence ENSEMBL: ENSMUSP00000108235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
AlphaFold Q8C102
Predicted Effect possibly damaging
Transcript: ENSMUST00000112616
AA Change: F834L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: F834L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166729
AA Change: F834L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: F834L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,179,220 T422S possibly damaging Het
Acsl3 T G 1: 78,696,906 I390S probably damaging Het
Adam3 A G 8: 24,681,589 V742A probably benign Het
Adgra3 A T 5: 49,998,276 I450K possibly damaging Het
Adgrb2 T C 4: 129,992,108 S14P possibly damaging Het
Arfgef3 T A 10: 18,599,280 I1553F probably damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Ccdc27 A G 4: 154,032,984 L502P probably damaging Het
Ccdc50 T A 16: 27,389,950 L5Q Het
Cdh16 C T 8: 104,615,202 G777D probably damaging Het
Cntn2 C A 1: 132,521,283 V663L probably benign Het
Cpne4 T A 9: 105,007,634 V343E probably damaging Het
Dctpp1 A T 7: 127,257,103 I149N probably benign Het
Dlg5 T C 14: 24,154,677 N1266S probably damaging Het
Dst A G 1: 34,193,064 D3246G probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Erbin T C 13: 103,850,784 T423A probably damaging Het
Erich5 C T 15: 34,471,417 P264L possibly damaging Het
Fam90a1a A G 8: 21,963,075 M149V probably benign Het
Fbxl18 C T 5: 142,895,115 G62R possibly damaging Het
Fech A G 18: 64,458,196 S386P possibly damaging Het
Fhl3 T A 4: 124,707,705 probably null Het
Fkbp5 A G 17: 28,410,584 S256P probably benign Het
Frem2 A G 3: 53,657,083 M1T probably null Het
Gm3618 G T 14: 6,314,964 T99N unknown Het
Gm884 A T 11: 103,604,580 D2804E unknown Het
Gm9195 T A 14: 72,463,106 Q1127L possibly damaging Het
Gpsm1 A G 2: 26,346,823 D643G probably damaging Het
Grm4 A G 17: 27,435,209 V589A possibly damaging Het
Gskip T A 12: 105,698,793 F30L probably benign Het
Haus3 T A 5: 34,154,108 probably null Het
Heatr1 T C 13: 12,406,608 F463S probably damaging Het
Hmcn1 G A 1: 150,597,989 S4851F probably benign Het
Il16 A C 7: 83,722,549 F16L probably benign Het
Itga1 C A 13: 115,049,388 C26F possibly damaging Het
Itga6 A G 2: 71,838,412 E565G probably benign Het
Itgb4 A G 11: 115,979,639 H98R probably benign Het
Kidins220 T A 12: 24,988,559 S37T probably benign Het
Lrrk2 C T 15: 91,700,426 L349F probably damaging Het
Malrd1 T G 2: 16,255,266 I2099S unknown Het
Mapk8ip1 A G 2: 92,386,369 I492T possibly damaging Het
Mest T A 6: 30,742,142 D68E Het
Mthfd1l A G 10: 3,984,154 D162G probably benign Het
Nalcn A T 14: 123,281,155 D1657E probably benign Het
Nbeal2 C A 9: 110,633,047 V1475F probably damaging Het
Nf1 C A 11: 79,440,890 Q684K possibly damaging Het
Olfr1116 T C 2: 87,268,982 L67P possibly damaging Het
Olfr1354 A G 10: 78,916,969 N43S probably damaging Het
Olfr1411 A T 1: 92,597,272 H251L probably damaging Het
Olfr1411 A T 1: 92,597,274 M252L probably benign Het
Opn5 T A 17: 42,592,902 T181S probably damaging Het
Orc4 T A 2: 48,937,522 R20* probably null Het
Pik3ca T C 3: 32,438,062 Y270H probably damaging Het
Pkn2 T C 3: 142,811,915 E474G probably null Het
Pnmal2 A T 7: 16,945,234 N48Y unknown Het
Polr1a G A 6: 71,965,558 M1127I probably benign Het
Ptpre A C 7: 135,672,820 D507A probably damaging Het
Rab3gap2 T C 1: 185,251,134 V490A probably damaging Het
Rab44 A T 17: 29,135,364 probably benign Het
Rchy1 G T 5: 91,957,972 T39N probably benign Het
Ripor1 A G 8: 105,621,431 D1146G unknown Het
Sh3yl1 A T 12: 30,922,336 I35F possibly damaging Het
Slc22a5 A G 11: 53,873,793 F276L probably benign Het
Slc8a3 T A 12: 81,314,434 D537V possibly damaging Het
Smc4 T A 3: 69,034,453 I1263N probably damaging Het
Snai2 A T 16: 14,707,256 T209S possibly damaging Het
Stam2 A T 2: 52,714,891 Y211N probably damaging Het
Stxbp1 A G 2: 32,818,505 S83P probably damaging Het
Susd4 T C 1: 182,888,824 F325L probably benign Het
Tmem245 A G 4: 56,947,236 V59A probably benign Het
Tnk2 A G 16: 32,675,671 D469G probably damaging Het
Tpx2 A G 2: 152,890,597 D597G probably damaging Het
Ube2w A T 1: 16,541,787 S170R Het
Vmn2r102 A T 17: 19,676,666 I92F probably damaging Het
Vmn2r11 T A 5: 109,052,063 E508V possibly damaging Het
Vmn2r30 T A 7: 7,337,433 I21F possibly damaging Het
Yipf2 G A 9: 21,590,193 T187M possibly damaging Het
Zbtb8a T A 4: 129,354,474 K335* probably null Het
Zfp609 T C 9: 65,701,046 D1184G possibly damaging Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0113:Galnt5 UTSW 2 57998877 missense probably benign
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R0677:Galnt5 UTSW 2 57998980 nonsense probably null
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5118:Galnt5 UTSW 2 58015003 missense probably damaging 1.00
R5497:Galnt5 UTSW 2 58025328 missense probably damaging 0.99
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6237:Galnt5 UTSW 2 58035249 missense probably damaging 0.96
R6805:Galnt5 UTSW 2 58035299 missense possibly damaging 0.82
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
R7347:Galnt5 UTSW 2 58017193 missense probably benign 0.33
R7419:Galnt5 UTSW 2 58014925 missense probably damaging 1.00
R7426:Galnt5 UTSW 2 58017139 missense probably damaging 0.99
R7492:Galnt5 UTSW 2 58026036 splice site probably null
R7539:Galnt5 UTSW 2 58035230 missense probably damaging 0.99
R7623:Galnt5 UTSW 2 58017210 missense probably damaging 0.99
R8135:Galnt5 UTSW 2 58014868 missense probably damaging 1.00
R8155:Galnt5 UTSW 2 57999415 missense probably benign 0.01
R8544:Galnt5 UTSW 2 58017148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCACAGTGATCGTCTTCC -3'
(R):5'- CAGACTGGGGAAGTGGACTTTG -3'

Sequencing Primer
(F):5'- GATCGTCTTCCTCTTCAACATAACAG -3'
(R):5'- CTTTGTAGTAAAGGATGGCACAG -3'
Posted On 2022-03-25