Mutagenetix > Incidental Mutations

Incidental Mutation 'R9267:Galnt5'

702588

Institutional Source

Beutler Lab

Gene Symbol

Galnt5

Ensembl Gene

ENSMUSG00000026828

Gene Name

polypeptide N-acetylgalactosaminyltransferase 5

Synonyms

ppGaNTase-T5

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9267 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57997884-58045860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58035208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 834 (F834L)

Ref Sequence

ENSEMBL: ENSMUSP00000108235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]

AlphaFold

Q8C102

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112616
AA Change: F834L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: F834L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	1.3e-33	PFAM
Pfam:Glyco_transf_7C	653	718	1.9e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166729
AA Change: F834L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: F834L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	2.1e-30	PFAM
Pfam:Glyco_transf_7C	652	718	7e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	A	15: 91,179,220	T422S	possibly damaging	Het
Acsl3	T	G	1: 78,696,906	I390S	probably damaging	Het
Adam3	A	G	8: 24,681,589	V742A	probably benign	Het
Adgra3	A	T	5: 49,998,276	I450K	possibly damaging	Het
Adgrb2	T	C	4: 129,992,108	S14P	possibly damaging	Het
Arfgef3	T	A	10: 18,599,280	I1553F	probably damaging	Het
Btbd16	C	T	7: 130,815,786	R344C	probably damaging	Het
Ccdc27	A	G	4: 154,032,984	L502P	probably damaging	Het
Ccdc50	T	A	16: 27,389,950	L5Q		Het
Cdh16	C	T	8: 104,615,202	G777D	probably damaging	Het
Cntn2	C	A	1: 132,521,283	V663L	probably benign	Het
Cpne4	T	A	9: 105,007,634	V343E	probably damaging	Het
Dctpp1	A	T	7: 127,257,103	I149N	probably benign	Het
Dlg5	T	C	14: 24,154,677	N1266S	probably damaging	Het
Dst	A	G	1: 34,193,064	D3246G	probably benign	Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Erbin	T	C	13: 103,850,784	T423A	probably damaging	Het
Erich5	C	T	15: 34,471,417	P264L	possibly damaging	Het
Fam90a1a	A	G	8: 21,963,075	M149V	probably benign	Het
Fbxl18	C	T	5: 142,895,115	G62R	possibly damaging	Het
Fech	A	G	18: 64,458,196	S386P	possibly damaging	Het
Fhl3	T	A	4: 124,707,705		probably null	Het
Fkbp5	A	G	17: 28,410,584	S256P	probably benign	Het
Frem2	A	G	3: 53,657,083	M1T	probably null	Het
Gm3618	G	T	14: 6,314,964	T99N	unknown	Het
Gm884	A	T	11: 103,604,580	D2804E	unknown	Het
Gm9195	T	A	14: 72,463,106	Q1127L	possibly damaging	Het
Gpsm1	A	G	2: 26,346,823	D643G	probably damaging	Het
Grm4	A	G	17: 27,435,209	V589A	possibly damaging	Het
Gskip	T	A	12: 105,698,793	F30L	probably benign	Het
Haus3	T	A	5: 34,154,108		probably null	Het
Heatr1	T	C	13: 12,406,608	F463S	probably damaging	Het
Hmcn1	G	A	1: 150,597,989	S4851F	probably benign	Het
Il16	A	C	7: 83,722,549	F16L	probably benign	Het
Itga1	C	A	13: 115,049,388	C26F	possibly damaging	Het
Itga6	A	G	2: 71,838,412	E565G	probably benign	Het
Itgb4	A	G	11: 115,979,639	H98R	probably benign	Het
Kidins220	T	A	12: 24,988,559	S37T	probably benign	Het
Lrrk2	C	T	15: 91,700,426	L349F	probably damaging	Het
Malrd1	T	G	2: 16,255,266	I2099S	unknown	Het
Mapk8ip1	A	G	2: 92,386,369	I492T	possibly damaging	Het
Mest	T	A	6: 30,742,142	D68E		Het
Mthfd1l	A	G	10: 3,984,154	D162G	probably benign	Het
Nalcn	A	T	14: 123,281,155	D1657E	probably benign	Het
Nbeal2	C	A	9: 110,633,047	V1475F	probably damaging	Het
Nf1	C	A	11: 79,440,890	Q684K	possibly damaging	Het
Olfr1116	T	C	2: 87,268,982	L67P	possibly damaging	Het
Olfr1354	A	G	10: 78,916,969	N43S	probably damaging	Het
Olfr1411	A	T	1: 92,597,272	H251L	probably damaging	Het
Olfr1411	A	T	1: 92,597,274	M252L	probably benign	Het
Opn5	T	A	17: 42,592,902	T181S	probably damaging	Het
Orc4	T	A	2: 48,937,522	R20*	probably null	Het
Pik3ca	T	C	3: 32,438,062	Y270H	probably damaging	Het
Pkn2	T	C	3: 142,811,915	E474G	probably null	Het
Pnmal2	A	T	7: 16,945,234	N48Y	unknown	Het
Polr1a	G	A	6: 71,965,558	M1127I	probably benign	Het
Ptpre	A	C	7: 135,672,820	D507A	probably damaging	Het
Rab3gap2	T	C	1: 185,251,134	V490A	probably damaging	Het
Rab44	A	T	17: 29,135,364		probably benign	Het
Rchy1	G	T	5: 91,957,972	T39N	probably benign	Het
Ripor1	A	G	8: 105,621,431	D1146G	unknown	Het
Sh3yl1	A	T	12: 30,922,336	I35F	possibly damaging	Het
Slc22a5	A	G	11: 53,873,793	F276L	probably benign	Het
Slc8a3	T	A	12: 81,314,434	D537V	possibly damaging	Het
Smc4	T	A	3: 69,034,453	I1263N	probably damaging	Het
Snai2	A	T	16: 14,707,256	T209S	possibly damaging	Het
Stam2	A	T	2: 52,714,891	Y211N	probably damaging	Het
Stxbp1	A	G	2: 32,818,505	S83P	probably damaging	Het
Susd4	T	C	1: 182,888,824	F325L	probably benign	Het
Tmem245	A	G	4: 56,947,236	V59A	probably benign	Het
Tnk2	A	G	16: 32,675,671	D469G	probably damaging	Het
Tpx2	A	G	2: 152,890,597	D597G	probably damaging	Het
Ube2w	A	T	1: 16,541,787	S170R		Het
Vmn2r102	A	T	17: 19,676,666	I92F	probably damaging	Het
Vmn2r11	T	A	5: 109,052,063	E508V	possibly damaging	Het
Vmn2r30	T	A	7: 7,337,433	I21F	possibly damaging	Het
Yipf2	G	A	9: 21,590,193	T187M	possibly damaging	Het
Zbtb8a	T	A	4: 129,354,474	K335*	probably null	Het
Zfp609	T	C	9: 65,701,046	D1184G	possibly damaging	Het

Other mutations in Galnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Galnt5	APN	2	57998973	missense	probably benign
IGL00515:Galnt5	APN	2	57999068	missense	probably benign	0.02
IGL00950:Galnt5	APN	2	57999132	missense	probably benign	0.00
IGL00973:Galnt5	APN	2	57998939	missense	probably benign	0.02
IGL01152:Galnt5	APN	2	58025393	missense	probably benign	0.17
IGL01305:Galnt5	APN	2	58025342	nonsense	probably null
IGL01661:Galnt5	APN	2	57999482	missense	probably benign	0.03
IGL01719:Galnt5	APN	2	57998543	missense	probably damaging	1.00
IGL02165:Galnt5	APN	2	57998865	missense	probably benign
IGL02795:Galnt5	APN	2	58027871	missense	probably damaging	1.00
IGL02943:Galnt5	APN	2	57999768	missense	probably damaging	1.00
IGL03218:Galnt5	APN	2	57999389	missense	possibly damaging	0.59
ANU22:Galnt5	UTSW	2	58025342	nonsense	probably null
R0082:Galnt5	UTSW	2	57999035	missense	possibly damaging	0.92
R0113:Galnt5	UTSW	2	57998877	missense	probably benign
R0445:Galnt5	UTSW	2	57998950	missense	probably benign
R0517:Galnt5	UTSW	2	58035373	splice site	probably benign
R0609:Galnt5	UTSW	2	58024625	missense	possibly damaging	0.90
R0639:Galnt5	UTSW	2	57999395	missense	probably benign	0.07
R0646:Galnt5	UTSW	2	57999085	missense	probably benign	0.00
R0677:Galnt5	UTSW	2	57998980	nonsense	probably null
R1808:Galnt5	UTSW	2	58026125	missense	probably benign	0.24
R1927:Galnt5	UTSW	2	57998603	missense	probably benign	0.00
R1980:Galnt5	UTSW	2	58024723	critical splice donor site	probably null
R2517:Galnt5	UTSW	2	57999413	missense	probably benign	0.00
R4044:Galnt5	UTSW	2	57998460	missense	probably damaging	1.00
R4154:Galnt5	UTSW	2	57998493	missense	probably damaging	1.00
R4411:Galnt5	UTSW	2	57999195	missense	probably benign	0.01
R4703:Galnt5	UTSW	2	57998907	missense	possibly damaging	0.96
R4767:Galnt5	UTSW	2	58028144	missense	possibly damaging	0.91
R5118:Galnt5	UTSW	2	58015003	missense	probably damaging	1.00
R5497:Galnt5	UTSW	2	58025328	missense	probably damaging	0.99
R5506:Galnt5	UTSW	2	57999625	missense	probably benign
R5548:Galnt5	UTSW	2	58014910	missense	probably damaging	0.99
R5758:Galnt5	UTSW	2	57998430	missense	probably benign	0.19
R5937:Galnt5	UTSW	2	58038937	missense	probably benign	0.00
R6237:Galnt5	UTSW	2	58035249	missense	probably damaging	0.96
R6805:Galnt5	UTSW	2	58035299	missense	possibly damaging	0.82
R6959:Galnt5	UTSW	2	57999219	missense	probably benign	0.39
R7070:Galnt5	UTSW	2	57998609	missense	probably benign	0.00
R7179:Galnt5	UTSW	2	57998609	missense	probably benign	0.06
R7347:Galnt5	UTSW	2	58017193	missense	probably benign	0.33
R7419:Galnt5	UTSW	2	58014925	missense	probably damaging	1.00
R7426:Galnt5	UTSW	2	58017139	missense	probably damaging	0.99
R7492:Galnt5	UTSW	2	58026036	splice site	probably null
R7539:Galnt5	UTSW	2	58035230	missense	probably damaging	0.99
R7623:Galnt5	UTSW	2	58017210	missense	probably damaging	0.99
R8135:Galnt5	UTSW	2	58014868	missense	probably damaging	1.00
R8155:Galnt5	UTSW	2	57999415	missense	probably benign	0.01
R8544:Galnt5	UTSW	2	58017148	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCCACAGTGATCGTCTTCC -3'
(R):5'- CAGACTGGGGAAGTGGACTTTG -3'

Sequencing Primer
(F):5'- GATCGTCTTCCTCTTCAACATAACAG -3'
(R):5'- CTTTGTAGTAAAGGATGGCACAG -3'

Posted On

2022-03-25