Incidental Mutation 'R0749:Ptdss1'
ID70262
Institutional Source Beutler Lab
Gene Symbol Ptdss1
Ensembl Gene ENSMUSG00000021518
Gene Namephosphatidylserine synthase 1
SynonymsPSS-1, PtdSer Synthase-1
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location66932830-66998401 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 66987850 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 390 (C390*)
Ref Sequence ENSEMBL: ENSMUSP00000021990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021990] [ENSMUST00000224244]
Predicted Effect probably null
Transcript: ENSMUST00000021990
AA Change: C390*
SMART Domains Protein: ENSMUSP00000021990
Gene: ENSMUSG00000021518
AA Change: C390*

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 72 89 N/A INTRINSIC
Pfam:PSS 96 372 1.3e-108 PFAM
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224244
Predicted Effect probably benign
Transcript: ENSMUST00000225347
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of phosphatidylserine from either phosphatidylcholine or phosphatidylethanolamine. Phosphatidylserine localizes to the mitochondria-associated membrane of the endoplasmic reticulum, where it serves a structural role as well as a signaling role. Defects in this gene are a cause of Lenz-Majewski hyperostotic dwarfism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased phosphatidylethanolamine and phosphatidylserine levels in the liver but normal axon growth and life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Ptdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Ptdss1 APN 13 66987822 missense probably benign 0.02
IGL02798:Ptdss1 APN 13 66976760 missense probably damaging 1.00
IGL03114:Ptdss1 APN 13 66993994 nonsense probably null
R0344:Ptdss1 UTSW 13 66933572 missense probably damaging 1.00
R0591:Ptdss1 UTSW 13 66972650 splice site probably benign
R0759:Ptdss1 UTSW 13 66987804 missense probably damaging 1.00
R1140:Ptdss1 UTSW 13 66963356 missense probably benign 0.00
R1500:Ptdss1 UTSW 13 66995408 missense probably benign 0.04
R1676:Ptdss1 UTSW 13 66933637 missense probably damaging 1.00
R1761:Ptdss1 UTSW 13 66956412 missense possibly damaging 0.72
R2086:Ptdss1 UTSW 13 66953555 missense probably benign 0.00
R2087:Ptdss1 UTSW 13 66976817 splice site probably benign
R3962:Ptdss1 UTSW 13 66994011 missense probably benign 0.00
R4662:Ptdss1 UTSW 13 66933611 missense possibly damaging 0.95
R4707:Ptdss1 UTSW 13 66995418 critical splice donor site probably null
R4775:Ptdss1 UTSW 13 66987858 splice site probably null
R4993:Ptdss1 UTSW 13 66945288 missense probably benign 0.01
R5402:Ptdss1 UTSW 13 66933599 missense possibly damaging 0.88
R5463:Ptdss1 UTSW 13 66945301 missense probably damaging 1.00
R5643:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R5644:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R6043:Ptdss1 UTSW 13 66963369 missense probably damaging 1.00
R6145:Ptdss1 UTSW 13 66972637 critical splice donor site probably null
R6726:Ptdss1 UTSW 13 66953531 nonsense probably null
R7016:Ptdss1 UTSW 13 66972621 missense probably benign 0.00
R7116:Ptdss1 UTSW 13 66945327 missense probably benign 0.00
R7339:Ptdss1 UTSW 13 66963362 missense possibly damaging 0.78
R7836:Ptdss1 UTSW 13 66933655 missense probably benign
R7919:Ptdss1 UTSW 13 66933655 missense probably benign
R8015:Ptdss1 UTSW 13 66963343 missense possibly damaging 0.87
RF044:Ptdss1 UTSW 13 66945348 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AAAGACAGTGGGTTCTCTGTGCTTC -3'
(R):5'- TGGCTACAGTGACACATTGCAGATAC -3'

Sequencing Primer
(F):5'- ACTCTCCAGTAATGCTGAGTG -3'
(R):5'- CACATTGCAGATACTGTAAGGCTG -3'
Posted On2013-09-30