Incidental Mutation 'R0749:Bmp4'
ID70263
Institutional Source Beutler Lab
Gene Symbol Bmp4
Ensembl Gene ENSMUSG00000021835
Gene Namebone morphogenetic protein 4
SynonymsBmp-4, Bmp2b-1, Bmp2b1, Bmp2b
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location46383520-46390669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46384613 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 158 (E158G)
Ref Sequence ENSEMBL: ENSMUSP00000098242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074077] [ENSMUST00000100676] [ENSMUST00000111826] [ENSMUST00000141358]
Predicted Effect probably damaging
Transcript: ENSMUST00000074077
AA Change: E158G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073720
Gene: ENSMUSG00000021835
AA Change: E158G

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 276 1.7e-77 PFAM
TGFB 308 408 4.53e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100676
AA Change: E158G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098242
Gene: ENSMUSG00000021835
AA Change: E158G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 39 276 3.7e-55 PFAM
TGFB 308 408 4.53e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135408
Predicted Effect probably benign
Transcript: ENSMUST00000141358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228667
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Homozygous knockout mice die in utero, while a conditional knockout mouse exhibits defects in heart development. Transgenic mice overexpressing this gene in a neuron-specific manner exhibit a phenotype resembling the rare hereditary connective tissue disease, fibrodysplasia ossificans progressiva. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted mutants have wide ranging effects, including embryonic lethality, aberrant mesoderm differentation, developmental retardation and disorganized posterior structures; heterozygous null mutants display anomalies of the kidney and urinary tract; other targeted mutants display failure of lens induction and lack primordial germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Bmp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Bmp4 APN 14 46384481 missense probably damaging 1.00
R1052:Bmp4 UTSW 14 46383903 missense probably damaging 1.00
R3104:Bmp4 UTSW 14 46385981 missense probably benign 0.05
R3787:Bmp4 UTSW 14 46385714 critical splice donor site probably null
R3938:Bmp4 UTSW 14 46384079 missense probably damaging 1.00
R4768:Bmp4 UTSW 14 46385924 missense probably damaging 1.00
R5102:Bmp4 UTSW 14 46384001 missense probably damaging 1.00
R5367:Bmp4 UTSW 14 46384493 missense possibly damaging 0.82
R5421:Bmp4 UTSW 14 46385898 missense probably damaging 0.98
R7189:Bmp4 UTSW 14 46383999 missense probably damaging 1.00
Z1176:Bmp4 UTSW 14 46384628 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGCTCACATCGAAAGTTTCCCACC -3'
(R):5'- CCCTTCTGTAACATGATCAACAAGGCG -3'

Sequencing Primer
(F):5'- GAAAGTTTCCCACCGTGTCAC -3'
(R):5'- AGGCACAGTAATTTCCTCCC -3'
Posted On2013-09-30