Incidental Mutation 'R9268:Myo3b'
ID 702659
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9268 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to C at 70426961 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Cysteine at position 1334 (*1334C)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably null
Transcript: ENSMUST00000060208
AA Change: *1334C
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: *1334C

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112243
AA Change: *1306C
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: *1306C

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,061,723 T218A possibly damaging Het
Acadsb C T 7: 131,432,034 T260I probably damaging Het
Acap2 A T 16: 31,136,574 V161E probably damaging Het
Adnp A G 2: 168,189,313 I26T possibly damaging Het
Alk T C 17: 71,874,195 T1367A probably damaging Het
Apoa5 A T 9: 46,270,421 D265V probably benign Het
Asb15 G A 6: 24,566,299 R417H probably benign Het
Atg2a A C 19: 6,241,875 H27P probably damaging Het
Bace1 G T 9: 45,855,984 probably benign Het
Camk1d A G 2: 5,299,090 S351P probably benign Het
Carf C A 1: 60,109,399 Q85K possibly damaging Het
Cdh19 A G 1: 110,949,381 F76S probably damaging Het
Ces1b A C 8: 93,071,955 V201G probably damaging Het
Clk1 A G 1: 58,419,723 L133S unknown Het
Clstn3 G A 6: 124,456,921 L427F probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cyp2j11 A T 4: 96,319,544 probably benign Het
Dctn4 T A 18: 60,526,232 M1K probably null Het
Dnah12 A G 14: 26,849,298 K2788R possibly damaging Het
Dtna T A 18: 23,569,586 V58D possibly damaging Het
Egfr T A 11: 16,905,410 D898E probably damaging Het
Eif2ak4 G C 2: 118,441,220 probably null Het
Enam A G 5: 88,492,919 M147V probably benign Het
Etaa1 A T 11: 17,946,419 V566E probably damaging Het
F13a1 C T 13: 36,892,936 G593D probably benign Het
Fam126b T C 1: 58,552,202 D94G probably damaging Het
Far2 C T 6: 148,158,920 T257I probably benign Het
Fat4 C T 3: 38,888,247 R430C probably damaging Het
Fhod3 T C 18: 24,709,775 probably null Het
Fuca2 G A 10: 13,514,819 W453* probably null Het
Gm11238 T C 4: 73,657,136 S351P probably damaging Het
Hfe2 T C 3: 96,528,565 F380L probably benign Het
Igkv4-72 A T 6: 69,226,996 Y70* probably null Het
Kdm1b A C 13: 47,064,229 N388T probably benign Het
Klri2 A T 6: 129,733,074 W188R probably damaging Het
Lama4 A G 10: 39,074,692 Y997C probably damaging Het
Lrrc73 T C 17: 46,254,609 S89P probably benign Het
Macf1 T C 4: 123,473,789 E2393G probably damaging Het
Mfsd14b A G 13: 65,075,041 L265P probably damaging Het
Nfatc4 A T 14: 55,827,228 I391F probably damaging Het
Nlgn1 A T 3: 25,436,384 M393K probably damaging Het
Olfr1499 A T 19: 13,815,024 C189S probably damaging Het
Olfr183 T G 16: 58,999,720 F12V probably damaging Het
Otogl A T 10: 107,781,056 C1787S probably damaging Het
Papola A G 12: 105,799,773 E44G probably benign Het
Parp1 A G 1: 180,587,944 K443E possibly damaging Het
Pcdh15 A T 10: 74,643,623 E522V probably benign Het
Peli2 A G 14: 48,281,470 E225G probably benign Het
Pus7l T C 15: 94,533,564 I395V probably benign Het
Rmi1 T C 13: 58,408,039 I34T probably damaging Het
Rnf220 A G 4: 117,489,636 I193T probably benign Het
Rpgrip1l T C 8: 91,280,727 T412A probably benign Het
Shisa7 T G 7: 4,834,334 D244A probably damaging Het
Slco3a1 T C 7: 74,303,198 T538A probably benign Het
Sptlc1 A T 13: 53,358,836 I162N probably damaging Het
Ssrp1 C A 2: 85,040,262 probably benign Het
Sytl2 A G 7: 90,385,151 N523S probably benign Het
Tcf20 A G 15: 82,856,504 S249P probably benign Het
Thumpd3 T A 6: 113,066,858 F411L probably damaging Het
Ttc30a1 A T 2: 75,980,935 V268E probably benign Het
Ttn A G 2: 76,937,735 W3007R unknown Het
Ulbp1 A T 10: 7,446,392 L295Q unknown Het
Vmn1r29 T A 6: 58,307,592 V99E probably damaging Het
Wdr47 T C 3: 108,618,496 F112L probably benign Het
Wnk2 A G 13: 49,082,031 V636A possibly damaging Het
Zswim8 T C 14: 20,711,840 L227P probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70245304 missense probably benign 0.43
R9671:Myo3b UTSW 2 70256564 missense probably damaging 1.00
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
R9791:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTTTAGGTGTACCAGGGATG -3'
(R):5'- AACACGGGTTCTGTGACTCAG -3'

Sequencing Primer
(F):5'- ACCAGGGATGGTTGTGATATTTG -3'
(R):5'- TCTGTGACTCAGGCTGCAG -3'
Posted On 2022-03-25