Incidental Mutation 'R0749:Tmem63b'
ID70269
Institutional Source Beutler Lab
Gene Symbol Tmem63b
Ensembl Gene ENSMUSG00000036026
Gene Nametransmembrane protein 63b
Synonyms
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45660171-45686905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45666115 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 442 (F442S)
Ref Sequence ENSEMBL: ENSMUSP00000109151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113523] [ENSMUST00000145873] [ENSMUST00000156254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113523
AA Change: F442S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109151
Gene: ENSMUSG00000036026
AA Change: F442S

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 101 226 2.5e-23 PFAM
Pfam:PHM7_cyt 274 344 9.1e-10 PFAM
Pfam:RSN1_7TM 362 706 5.3e-96 PFAM
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129177
Predicted Effect probably benign
Transcript: ENSMUST00000145873
SMART Domains Protein: ENSMUSP00000121681
Gene: ENSMUSG00000036026

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:RSN1_TM 87 213 1.1e-24 PFAM
Blast:RRM 228 308 3e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156224
Predicted Effect probably benign
Transcript: ENSMUST00000156254
SMART Domains Protein: ENSMUSP00000118838
Gene: ENSMUSG00000036026

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 102 226 3.3e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Tmem63b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Tmem63b APN 17 45663571 missense probably damaging 1.00
IGL02486:Tmem63b APN 17 45673983 missense probably damaging 0.97
IGL02519:Tmem63b APN 17 45665208 missense possibly damaging 0.46
IGL02893:Tmem63b APN 17 45661900 missense probably damaging 1.00
IGL03137:Tmem63b APN 17 45664995 missense probably damaging 0.98
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0276:Tmem63b UTSW 17 45675373 splice site probably benign
R0441:Tmem63b UTSW 17 45666315 critical splice donor site probably null
R0729:Tmem63b UTSW 17 45674134 missense probably damaging 1.00
R0834:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0835:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0865:Tmem63b UTSW 17 45661519 missense probably benign 0.02
R1144:Tmem63b UTSW 17 45666427 missense probably benign 0.07
R1448:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1538:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1853:Tmem63b UTSW 17 45661297 missense possibly damaging 0.68
R1935:Tmem63b UTSW 17 45678961 critical splice donor site probably null
R2078:Tmem63b UTSW 17 45663536 missense possibly damaging 0.91
R2518:Tmem63b UTSW 17 45666154 missense probably benign
R3911:Tmem63b UTSW 17 45677958 missense probably damaging 1.00
R5093:Tmem63b UTSW 17 45660874 missense probably damaging 1.00
R5186:Tmem63b UTSW 17 45661477 missense possibly damaging 0.68
R5364:Tmem63b UTSW 17 45664727 unclassified probably benign
R5396:Tmem63b UTSW 17 45669962 missense possibly damaging 0.72
R5548:Tmem63b UTSW 17 45664958 missense probably damaging 0.98
R5582:Tmem63b UTSW 17 45667763 missense probably benign
R5998:Tmem63b UTSW 17 45670000 missense possibly damaging 0.94
R6198:Tmem63b UTSW 17 45661516 missense probably benign 0.00
R6656:Tmem63b UTSW 17 45667708 missense probably benign
R6808:Tmem63b UTSW 17 45660808 missense probably benign 0.13
R6967:Tmem63b UTSW 17 45666632 missense probably benign 0.00
R7089:Tmem63b UTSW 17 45667783 missense probably benign 0.00
R7181:Tmem63b UTSW 17 45673168 missense probably benign 0.00
R7214:Tmem63b UTSW 17 45661822 missense probably benign 0.02
R7267:Tmem63b UTSW 17 45666122 missense probably benign
R7323:Tmem63b UTSW 17 45660847 missense possibly damaging 0.86
R7346:Tmem63b UTSW 17 45666591 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAAGCATCCTGGAAGCACCTG -3'
(R):5'- AAGCACTGCATATCTCCAACTGGAC -3'

Sequencing Primer
(F):5'- TGGAGCACCCAGAGCTATG -3'
(R):5'- CCTCAGAACATCTATTGGTGAGC -3'
Posted On2013-09-30