Incidental Mutation 'R9268:Kdm1b'
ID 702696
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Name lysine (K)-specific demethylase 1B
Synonyms Aof1, 4632428N09Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.504) question?
Stock # R9268 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47196849-47238085 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 47217705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 388 (N388T)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
AlphaFold Q8CIG3
Predicted Effect probably benign
Transcript: ENSMUST00000037025
AA Change: N388T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: N388T

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080
AA Change: N104T

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,969,030 (GRCm39) T218A possibly damaging Het
Acadsb C T 7: 131,033,763 (GRCm39) T260I probably damaging Het
Acap2 A T 16: 30,955,392 (GRCm39) V161E probably damaging Het
Adnp A G 2: 168,031,233 (GRCm39) I26T possibly damaging Het
Alk T C 17: 72,181,190 (GRCm39) T1367A probably damaging Het
Apoa5 A T 9: 46,181,719 (GRCm39) D265V probably benign Het
Asb15 G A 6: 24,566,298 (GRCm39) R417H probably benign Het
Atg2a A C 19: 6,291,905 (GRCm39) H27P probably damaging Het
Bace1 G T 9: 45,767,282 (GRCm39) probably benign Het
Camk1d A G 2: 5,303,901 (GRCm39) S351P probably benign Het
Carf C A 1: 60,148,558 (GRCm39) Q85K possibly damaging Het
Cdh19 A G 1: 110,877,111 (GRCm39) F76S probably damaging Het
Ces1b A C 8: 93,798,583 (GRCm39) V201G probably damaging Het
Clk1 A G 1: 58,458,882 (GRCm39) L133S unknown Het
Clstn3 G A 6: 124,433,880 (GRCm39) L427F probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cyp2j11 A T 4: 96,207,781 (GRCm39) probably benign Het
Dctn4 T A 18: 60,659,304 (GRCm39) M1K probably null Het
Dnah12 A G 14: 26,571,255 (GRCm39) K2788R possibly damaging Het
Dtna T A 18: 23,702,643 (GRCm39) V58D possibly damaging Het
Egfr T A 11: 16,855,410 (GRCm39) D898E probably damaging Het
Eif2ak4 G C 2: 118,271,701 (GRCm39) probably null Het
Enam A G 5: 88,640,778 (GRCm39) M147V probably benign Het
Etaa1 A T 11: 17,896,419 (GRCm39) V566E probably damaging Het
F13a1 C T 13: 37,076,910 (GRCm39) G593D probably benign Het
Far2 C T 6: 148,060,418 (GRCm39) T257I probably benign Het
Fat4 C T 3: 38,942,396 (GRCm39) R430C probably damaging Het
Fhod3 T C 18: 24,842,832 (GRCm39) probably null Het
Fuca2 G A 10: 13,390,563 (GRCm39) W453* probably null Het
Hjv T C 3: 96,435,881 (GRCm39) F380L probably benign Het
Hycc2 T C 1: 58,591,361 (GRCm39) D94G probably damaging Het
Ift70a1 A T 2: 75,811,279 (GRCm39) V268E probably benign Het
Igkv4-72 A T 6: 69,203,980 (GRCm39) Y70* probably null Het
Klri2 A T 6: 129,710,037 (GRCm39) W188R probably damaging Het
Lama4 A G 10: 38,950,688 (GRCm39) Y997C probably damaging Het
Lrrc73 T C 17: 46,565,535 (GRCm39) S89P probably benign Het
Macf1 T C 4: 123,367,582 (GRCm39) E2393G probably damaging Het
Mfsd14b A G 13: 65,222,855 (GRCm39) L265P probably damaging Het
Msantd5f3 T C 4: 73,575,373 (GRCm39) S351P probably damaging Het
Myo3b A C 2: 70,257,305 (GRCm39) *1334C probably null Het
Nfatc4 A T 14: 56,064,685 (GRCm39) I391F probably damaging Het
Nlgn1 A T 3: 25,490,548 (GRCm39) M393K probably damaging Het
Or5h17 T G 16: 58,820,083 (GRCm39) F12V probably damaging Het
Or9i14 A T 19: 13,792,388 (GRCm39) C189S probably damaging Het
Otogl A T 10: 107,616,917 (GRCm39) C1787S probably damaging Het
Papola A G 12: 105,766,032 (GRCm39) E44G probably benign Het
Parp1 A G 1: 180,415,509 (GRCm39) K443E possibly damaging Het
Pcdh15 A T 10: 74,479,455 (GRCm39) E522V probably benign Het
Peli2 A G 14: 48,518,927 (GRCm39) E225G probably benign Het
Pus7l T C 15: 94,431,445 (GRCm39) I395V probably benign Het
Rmi1 T C 13: 58,555,853 (GRCm39) I34T probably damaging Het
Rnf220 A G 4: 117,346,833 (GRCm39) I193T probably benign Het
Rpgrip1l T C 8: 92,007,355 (GRCm39) T412A probably benign Het
Shisa7 T G 7: 4,837,333 (GRCm39) D244A probably damaging Het
Slco3a1 T C 7: 73,952,946 (GRCm39) T538A probably benign Het
Sptlc1 A T 13: 53,512,872 (GRCm39) I162N probably damaging Het
Ssrp1 C A 2: 84,870,606 (GRCm39) probably benign Het
Sytl2 A G 7: 90,034,359 (GRCm39) N523S probably benign Het
Tcf20 A G 15: 82,740,705 (GRCm39) S249P probably benign Het
Thumpd3 T A 6: 113,043,819 (GRCm39) F411L probably damaging Het
Ttn A G 2: 76,768,079 (GRCm39) W3007R unknown Het
Ulbp1 A T 10: 7,396,392 (GRCm39) L295Q unknown Het
Vmn1r29 T A 6: 58,284,577 (GRCm39) V99E probably damaging Het
Wdr47 T C 3: 108,525,812 (GRCm39) F112L probably benign Het
Wnk2 A G 13: 49,235,507 (GRCm39) V636A possibly damaging Het
Zswim8 T C 14: 20,761,908 (GRCm39) L227P probably damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47,222,016 (GRCm39) missense probably benign 0.01
IGL00924:Kdm1b APN 13 47,221,956 (GRCm39) missense probably benign
IGL01553:Kdm1b APN 13 47,234,024 (GRCm39) missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47,227,213 (GRCm39) missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47,221,982 (GRCm39) missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47,214,331 (GRCm39) missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47,233,943 (GRCm39) missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47,202,742 (GRCm39) missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47,217,593 (GRCm39) missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47,207,195 (GRCm39) missense probably benign
R0426:Kdm1b UTSW 13 47,217,720 (GRCm39) splice site probably benign
R0599:Kdm1b UTSW 13 47,212,286 (GRCm39) missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47,222,079 (GRCm39) missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47,225,398 (GRCm39) missense probably benign 0.02
R1543:Kdm1b UTSW 13 47,221,997 (GRCm39) missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47,217,530 (GRCm39) missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47,217,707 (GRCm39) critical splice donor site probably null
R1669:Kdm1b UTSW 13 47,222,024 (GRCm39) missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47,214,244 (GRCm39) missense probably benign 0.00
R1860:Kdm1b UTSW 13 47,202,666 (GRCm39) missense probably benign 0.03
R1907:Kdm1b UTSW 13 47,217,596 (GRCm39) missense probably benign 0.00
R2225:Kdm1b UTSW 13 47,217,564 (GRCm39) frame shift probably null
R2239:Kdm1b UTSW 13 47,227,231 (GRCm39) missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47,217,564 (GRCm39) frame shift probably null
R2302:Kdm1b UTSW 13 47,217,564 (GRCm39) frame shift probably null
R2303:Kdm1b UTSW 13 47,217,564 (GRCm39) frame shift probably null
R2380:Kdm1b UTSW 13 47,227,231 (GRCm39) missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47,216,451 (GRCm39) missense probably benign 0.32
R3022:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47,216,496 (GRCm39) missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47,216,553 (GRCm39) missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47,214,369 (GRCm39) missense probably benign
R4906:Kdm1b UTSW 13 47,216,620 (GRCm39) critical splice donor site probably null
R4965:Kdm1b UTSW 13 47,227,843 (GRCm39) missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47,230,962 (GRCm39) missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47,216,467 (GRCm39) missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47,216,445 (GRCm39) missense probably benign 0.35
R5541:Kdm1b UTSW 13 47,232,672 (GRCm39) missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47,216,622 (GRCm39) splice site probably null
R6046:Kdm1b UTSW 13 47,232,729 (GRCm39) missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47,222,012 (GRCm39) missense probably benign 0.00
R6903:Kdm1b UTSW 13 47,227,880 (GRCm39) missense probably benign 0.00
R7831:Kdm1b UTSW 13 47,204,098 (GRCm39) missense probably benign 0.17
R7973:Kdm1b UTSW 13 47,230,922 (GRCm39) missense probably benign 0.00
R8181:Kdm1b UTSW 13 47,205,377 (GRCm39) critical splice donor site probably null
R8248:Kdm1b UTSW 13 47,225,354 (GRCm39) intron probably benign
R8821:Kdm1b UTSW 13 47,217,617 (GRCm39) missense possibly damaging 0.94
R8831:Kdm1b UTSW 13 47,217,617 (GRCm39) missense possibly damaging 0.94
R8842:Kdm1b UTSW 13 47,231,832 (GRCm39) missense probably damaging 1.00
R8861:Kdm1b UTSW 13 47,217,582 (GRCm39) missense probably benign 0.02
R8885:Kdm1b UTSW 13 47,207,184 (GRCm39) nonsense probably null
R9038:Kdm1b UTSW 13 47,202,770 (GRCm39) missense probably benign 0.07
R9132:Kdm1b UTSW 13 47,225,458 (GRCm39) missense probably benign 0.05
R9616:Kdm1b UTSW 13 47,234,030 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACACAGGAAGCTCTCAC -3'
(R):5'- GATTTGCTCTCCCACGGTAC -3'

Sequencing Primer
(F):5'- GCTCTCACCCCTCAGAAGTG -3'
(R):5'- TGATGGTACCCGTCAGAAGTAACC -3'
Posted On 2022-03-25