Incidental Mutation 'R9268:Kdm1b'
ID 702696
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Name lysine (K)-specific demethylase 1B
Synonyms 4632428N09Rik, Aof1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock # R9268 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47043499-47085279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 47064229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 388 (N388T)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
AlphaFold Q8CIG3
Predicted Effect probably benign
Transcript: ENSMUST00000037025
AA Change: N388T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: N388T

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080
AA Change: N104T

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,061,723 T218A possibly damaging Het
Acadsb C T 7: 131,432,034 T260I probably damaging Het
Acap2 A T 16: 31,136,574 V161E probably damaging Het
Adnp A G 2: 168,189,313 I26T possibly damaging Het
Alk T C 17: 71,874,195 T1367A probably damaging Het
Apoa5 A T 9: 46,270,421 D265V probably benign Het
Asb15 G A 6: 24,566,299 R417H probably benign Het
Atg2a A C 19: 6,241,875 H27P probably damaging Het
Bace1 G T 9: 45,855,984 probably benign Het
Camk1d A G 2: 5,299,090 S351P probably benign Het
Carf C A 1: 60,109,399 Q85K possibly damaging Het
Cdh19 A G 1: 110,949,381 F76S probably damaging Het
Ces1b A C 8: 93,071,955 V201G probably damaging Het
Clk1 A G 1: 58,419,723 L133S unknown Het
Clstn3 G A 6: 124,456,921 L427F probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cyp2j11 A T 4: 96,319,544 probably benign Het
Dctn4 T A 18: 60,526,232 M1K probably null Het
Dnah12 A G 14: 26,849,298 K2788R possibly damaging Het
Dtna T A 18: 23,569,586 V58D possibly damaging Het
Egfr T A 11: 16,905,410 D898E probably damaging Het
Eif2ak4 G C 2: 118,441,220 probably null Het
Enam A G 5: 88,492,919 M147V probably benign Het
Etaa1 A T 11: 17,946,419 V566E probably damaging Het
F13a1 C T 13: 36,892,936 G593D probably benign Het
Fam126b T C 1: 58,552,202 D94G probably damaging Het
Far2 C T 6: 148,158,920 T257I probably benign Het
Fat4 C T 3: 38,888,247 R430C probably damaging Het
Fhod3 T C 18: 24,709,775 probably null Het
Fuca2 G A 10: 13,514,819 W453* probably null Het
Gm11238 T C 4: 73,657,136 S351P probably damaging Het
Hfe2 T C 3: 96,528,565 F380L probably benign Het
Igkv4-72 A T 6: 69,226,996 Y70* probably null Het
Klri2 A T 6: 129,733,074 W188R probably damaging Het
Lama4 A G 10: 39,074,692 Y997C probably damaging Het
Lrrc73 T C 17: 46,254,609 S89P probably benign Het
Macf1 T C 4: 123,473,789 E2393G probably damaging Het
Mfsd14b A G 13: 65,075,041 L265P probably damaging Het
Myo3b A C 2: 70,426,961 *1334C probably null Het
Nfatc4 A T 14: 55,827,228 I391F probably damaging Het
Nlgn1 A T 3: 25,436,384 M393K probably damaging Het
Olfr1499 A T 19: 13,815,024 C189S probably damaging Het
Olfr183 T G 16: 58,999,720 F12V probably damaging Het
Otogl A T 10: 107,781,056 C1787S probably damaging Het
Papola A G 12: 105,799,773 E44G probably benign Het
Parp1 A G 1: 180,587,944 K443E possibly damaging Het
Pcdh15 A T 10: 74,643,623 E522V probably benign Het
Peli2 A G 14: 48,281,470 E225G probably benign Het
Pus7l T C 15: 94,533,564 I395V probably benign Het
Rmi1 T C 13: 58,408,039 I34T probably damaging Het
Rnf220 A G 4: 117,489,636 I193T probably benign Het
Rpgrip1l T C 8: 91,280,727 T412A probably benign Het
Shisa7 T G 7: 4,834,334 D244A probably damaging Het
Slco3a1 T C 7: 74,303,198 T538A probably benign Het
Sptlc1 A T 13: 53,358,836 I162N probably damaging Het
Ssrp1 C A 2: 85,040,262 probably benign Het
Sytl2 A G 7: 90,385,151 N523S probably benign Het
Tcf20 A G 15: 82,856,504 S249P probably benign Het
Thumpd3 T A 6: 113,066,858 F411L probably damaging Het
Ttc30a1 A T 2: 75,980,935 V268E probably benign Het
Ttn A G 2: 76,937,735 W3007R unknown Het
Ulbp1 A T 10: 7,446,392 L295Q unknown Het
Vmn1r29 T A 6: 58,307,592 V99E probably damaging Het
Wdr47 T C 3: 108,618,496 F112L probably benign Het
Wnk2 A G 13: 49,082,031 V636A possibly damaging Het
Zswim8 T C 14: 20,711,840 L227P probably damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
R8821:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8831:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8842:Kdm1b UTSW 13 47078356 missense probably damaging 1.00
R8861:Kdm1b UTSW 13 47064106 missense probably benign 0.02
R8885:Kdm1b UTSW 13 47053708 nonsense probably null
R9038:Kdm1b UTSW 13 47049294 missense probably benign 0.07
R9132:Kdm1b UTSW 13 47071982 missense probably benign 0.05
R9616:Kdm1b UTSW 13 47080554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACACAGGAAGCTCTCAC -3'
(R):5'- GATTTGCTCTCCCACGGTAC -3'

Sequencing Primer
(F):5'- GCTCTCACCCCTCAGAAGTG -3'
(R):5'- TGATGGTACCCGTCAGAAGTAACC -3'
Posted On 2022-03-25