Incidental Mutation 'R9268:Rmi1'
ID 702699
Institutional Source Beutler Lab
Gene Symbol Rmi1
Ensembl Gene ENSMUSG00000035367
Gene Name RecQ mediated genome instability 1
Synonyms 4932432N11Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R9268 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 58550062-58558962 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58555853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 34 (I34T)
Ref Sequence ENSEMBL: ENSMUSP00000041035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042450] [ENSMUST00000116403] [ENSMUST00000224479] [ENSMUST00000225815] [ENSMUST00000225828]
AlphaFold Q9D4G9
Predicted Effect probably damaging
Transcript: ENSMUST00000042450
AA Change: I34T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041035
Gene: ENSMUSG00000035367
AA Change: I34T

DomainStartEndE-ValueType
DUF1767 11 104 1.62e-34 SMART
low complexity region 243 259 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:RMI1_C 479 614 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116403
SMART Domains Protein: ENSMUSP00000112104
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
low complexity region 252 279 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
KH 386 456 3.12e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224479
AA Change: I34T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225815
AA Change: I34T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225828
AA Change: I34T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RMI1 is a component of protein complexes that limit DNA crossover formation via the dissolution of double Holliday junctions (Raynard et al., 2006 [PubMed 16595695]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased weight and increased resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,969,030 (GRCm39) T218A possibly damaging Het
Acadsb C T 7: 131,033,763 (GRCm39) T260I probably damaging Het
Acap2 A T 16: 30,955,392 (GRCm39) V161E probably damaging Het
Adnp A G 2: 168,031,233 (GRCm39) I26T possibly damaging Het
Alk T C 17: 72,181,190 (GRCm39) T1367A probably damaging Het
Apoa5 A T 9: 46,181,719 (GRCm39) D265V probably benign Het
Asb15 G A 6: 24,566,298 (GRCm39) R417H probably benign Het
Atg2a A C 19: 6,291,905 (GRCm39) H27P probably damaging Het
Bace1 G T 9: 45,767,282 (GRCm39) probably benign Het
Camk1d A G 2: 5,303,901 (GRCm39) S351P probably benign Het
Carf C A 1: 60,148,558 (GRCm39) Q85K possibly damaging Het
Cdh19 A G 1: 110,877,111 (GRCm39) F76S probably damaging Het
Ces1b A C 8: 93,798,583 (GRCm39) V201G probably damaging Het
Clk1 A G 1: 58,458,882 (GRCm39) L133S unknown Het
Clstn3 G A 6: 124,433,880 (GRCm39) L427F probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cyp2j11 A T 4: 96,207,781 (GRCm39) probably benign Het
Dctn4 T A 18: 60,659,304 (GRCm39) M1K probably null Het
Dnah12 A G 14: 26,571,255 (GRCm39) K2788R possibly damaging Het
Dtna T A 18: 23,702,643 (GRCm39) V58D possibly damaging Het
Egfr T A 11: 16,855,410 (GRCm39) D898E probably damaging Het
Eif2ak4 G C 2: 118,271,701 (GRCm39) probably null Het
Enam A G 5: 88,640,778 (GRCm39) M147V probably benign Het
Etaa1 A T 11: 17,896,419 (GRCm39) V566E probably damaging Het
F13a1 C T 13: 37,076,910 (GRCm39) G593D probably benign Het
Far2 C T 6: 148,060,418 (GRCm39) T257I probably benign Het
Fat4 C T 3: 38,942,396 (GRCm39) R430C probably damaging Het
Fhod3 T C 18: 24,842,832 (GRCm39) probably null Het
Fuca2 G A 10: 13,390,563 (GRCm39) W453* probably null Het
Hjv T C 3: 96,435,881 (GRCm39) F380L probably benign Het
Hycc2 T C 1: 58,591,361 (GRCm39) D94G probably damaging Het
Ift70a1 A T 2: 75,811,279 (GRCm39) V268E probably benign Het
Igkv4-72 A T 6: 69,203,980 (GRCm39) Y70* probably null Het
Kdm1b A C 13: 47,217,705 (GRCm39) N388T probably benign Het
Klri2 A T 6: 129,710,037 (GRCm39) W188R probably damaging Het
Lama4 A G 10: 38,950,688 (GRCm39) Y997C probably damaging Het
Lrrc73 T C 17: 46,565,535 (GRCm39) S89P probably benign Het
Macf1 T C 4: 123,367,582 (GRCm39) E2393G probably damaging Het
Mfsd14b A G 13: 65,222,855 (GRCm39) L265P probably damaging Het
Msantd5f3 T C 4: 73,575,373 (GRCm39) S351P probably damaging Het
Myo3b A C 2: 70,257,305 (GRCm39) *1334C probably null Het
Nfatc4 A T 14: 56,064,685 (GRCm39) I391F probably damaging Het
Nlgn1 A T 3: 25,490,548 (GRCm39) M393K probably damaging Het
Or5h17 T G 16: 58,820,083 (GRCm39) F12V probably damaging Het
Or9i14 A T 19: 13,792,388 (GRCm39) C189S probably damaging Het
Otogl A T 10: 107,616,917 (GRCm39) C1787S probably damaging Het
Papola A G 12: 105,766,032 (GRCm39) E44G probably benign Het
Parp1 A G 1: 180,415,509 (GRCm39) K443E possibly damaging Het
Pcdh15 A T 10: 74,479,455 (GRCm39) E522V probably benign Het
Peli2 A G 14: 48,518,927 (GRCm39) E225G probably benign Het
Pus7l T C 15: 94,431,445 (GRCm39) I395V probably benign Het
Rnf220 A G 4: 117,346,833 (GRCm39) I193T probably benign Het
Rpgrip1l T C 8: 92,007,355 (GRCm39) T412A probably benign Het
Shisa7 T G 7: 4,837,333 (GRCm39) D244A probably damaging Het
Slco3a1 T C 7: 73,952,946 (GRCm39) T538A probably benign Het
Sptlc1 A T 13: 53,512,872 (GRCm39) I162N probably damaging Het
Ssrp1 C A 2: 84,870,606 (GRCm39) probably benign Het
Sytl2 A G 7: 90,034,359 (GRCm39) N523S probably benign Het
Tcf20 A G 15: 82,740,705 (GRCm39) S249P probably benign Het
Thumpd3 T A 6: 113,043,819 (GRCm39) F411L probably damaging Het
Ttn A G 2: 76,768,079 (GRCm39) W3007R unknown Het
Ulbp1 A T 10: 7,396,392 (GRCm39) L295Q unknown Het
Vmn1r29 T A 6: 58,284,577 (GRCm39) V99E probably damaging Het
Wdr47 T C 3: 108,525,812 (GRCm39) F112L probably benign Het
Wnk2 A G 13: 49,235,507 (GRCm39) V636A possibly damaging Het
Zswim8 T C 14: 20,761,908 (GRCm39) L227P probably damaging Het
Other mutations in Rmi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rmi1 APN 13 58,557,208 (GRCm39) missense probably damaging 1.00
IGL02304:Rmi1 APN 13 58,557,290 (GRCm39) nonsense probably null
R2046:Rmi1 UTSW 13 58,555,772 (GRCm39) missense probably benign
R2144:Rmi1 UTSW 13 58,555,797 (GRCm39) missense probably damaging 0.99
R4624:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4625:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4626:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4627:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4628:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4629:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R5288:Rmi1 UTSW 13 58,557,280 (GRCm39) missense probably damaging 1.00
R6939:Rmi1 UTSW 13 58,557,169 (GRCm39) missense probably benign
R7337:Rmi1 UTSW 13 58,557,393 (GRCm39) nonsense probably null
R7741:Rmi1 UTSW 13 58,557,067 (GRCm39) missense probably benign
R8871:Rmi1 UTSW 13 58,557,156 (GRCm39) missense probably benign 0.04
R9248:Rmi1 UTSW 13 58,556,899 (GRCm39) missense probably benign 0.04
R9269:Rmi1 UTSW 13 58,556,840 (GRCm39) missense probably benign 0.12
R9627:Rmi1 UTSW 13 58,557,366 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTCAAGGGGACACATATGCTC -3'
(R):5'- AATAAGCAGGCTGACTCACATC -3'

Sequencing Primer
(F):5'- ATGAGTGTAGCTAGTGCTG -3'
(R):5'- CAACCAAAGAATTGATCTGTAGAGC -3'
Posted On 2022-03-25