Incidental Mutation 'R0749:Lipn'
ID70271
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Namelipase, family member N
Synonyms2210418G03Rik, Lipl4
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34067358-34084918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34076979 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 206 (S206P)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
Predicted Effect probably damaging
Transcript: ENSMUST00000025682
AA Change: S206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: S206P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126710
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3237:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R4595:Lipn UTSW 19 34081350 missense probably damaging 1.00
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R6797:Lipn UTSW 19 34080760 missense probably benign
R7090:Lipn UTSW 19 34071780 missense possibly damaging 0.72
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CGGCATGTTTGTGTGCTCAGAAAAG -3'
(R):5'- ACTGGTGTAGGACTCACCTCATCTC -3'

Sequencing Primer
(F):5'- GGTTTCTATAGTTCACCAAGCAG -3'
(R):5'- CGTTGAAGTACATCCTCATGGAC -3'
Posted On2013-09-30