Incidental Mutation 'R0749:Sec31b'
ID70272
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R0749 (G1)
Quality Score220
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44524506 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 515 (V515M)
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably damaging
Transcript: ENSMUST00000063632
AA Change: V672M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: V672M

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111985
AA Change: V515M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: V515M

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165758
SMART Domains Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 intron probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7983:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGGGACCAATGGACTGCATC -3'
(R):5'- GCCAGTGAAGACACTTGTCTGAGAG -3'

Sequencing Primer
(F):5'- CACCTGATACAGTTGAGGTCCATAG -3'
(R):5'- GACACTTGTCTGAGAGATCACAGTC -3'
Posted On2013-09-30