Incidental Mutation 'R9269:Lamc3'
ID 702721
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Name laminin gamma 3
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 31777303-31836551 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 31818908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 1211 (S1211*)
Ref Sequence ENSEMBL: ENSMUSP00000028187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
AlphaFold Q9R0B6
Predicted Effect probably null
Transcript: ENSMUST00000028187
AA Change: S1211*
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: S1211*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138325
AA Change: S1222*
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: S1222*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,637,865 (GRCm39) S845P probably benign Het
Actn1 T A 12: 80,219,745 (GRCm39) N709Y probably benign Het
Alox5ap A G 5: 149,216,006 (GRCm39) Y64C probably damaging Het
Anapc4 T A 5: 53,018,620 (GRCm39) S521T possibly damaging Het
Ap3b1 C A 13: 94,540,570 (GRCm39) P164Q probably damaging Het
Arhgef26 A G 3: 62,247,920 (GRCm39) N335D probably damaging Het
Arrdc2 G A 8: 71,288,973 (GRCm39) A354V probably benign Het
Atg2b A G 12: 105,618,359 (GRCm39) S898P probably damaging Het
Atxn1 T A 13: 45,710,680 (GRCm39) T751S probably benign Het
Begain T A 12: 108,999,119 (GRCm39) R551W possibly damaging Het
Borcs8 C A 8: 70,594,521 (GRCm39) D15E probably benign Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Card11 A T 5: 140,892,516 (GRCm39) M183K probably damaging Het
Cldn3 T C 5: 135,015,579 (GRCm39) L94P probably damaging Het
Clvs2 A T 10: 33,419,422 (GRCm39) Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cop1 C T 1: 159,116,553 (GRCm39) P409L probably benign Het
Cplane1 A C 15: 8,248,500 (GRCm39) Q1683P probably damaging Het
Crhbp C A 13: 95,573,024 (GRCm39) A241S probably benign Het
Cyfip1 C A 7: 55,557,179 (GRCm39) S794* probably null Het
Dlg5 T A 14: 24,242,881 (GRCm39) H172L probably damaging Het
Doc2a T A 7: 126,450,159 (GRCm39) I199N probably benign Het
Dock3 T C 9: 106,818,522 (GRCm39) T1191A probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Eif4a3l2 C T 6: 116,529,317 (GRCm39) T398I probably damaging Het
Fcgr1 C T 3: 96,193,154 (GRCm39) R281H probably benign Het
Fndc10 T C 4: 155,779,205 (GRCm39) V83A possibly damaging Het
Galnt2 T A 8: 125,065,202 (GRCm39) I444K probably benign Het
Gcnt3 T C 9: 69,941,290 (GRCm39) Y426C probably damaging Het
Gtpbp1 C T 15: 79,601,855 (GRCm39) R533C probably damaging Het
Hid1 T C 11: 115,252,502 (GRCm39) E60G probably damaging Het
Ighv1-81 A T 12: 115,884,161 (GRCm39) L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,618,565 (GRCm39) probably null Het
Ilrun A C 17: 28,005,049 (GRCm39) Y169* probably null Het
Klf10 A G 15: 38,298,002 (GRCm39) L44P probably damaging Het
Lmx1a T A 1: 167,658,194 (GRCm39) H192Q probably benign Het
Nkx2-4 T C 2: 146,926,184 (GRCm39) H226R possibly damaging Het
Or2d2 T C 7: 106,727,833 (GRCm39) I256V probably benign Het
Or4a68 T A 2: 89,270,276 (GRCm39) M116L probably damaging Het
Or4k37 T C 2: 111,159,297 (GRCm39) F178L probably damaging Het
Or4p18 G A 2: 88,232,586 (GRCm39) R231C probably benign Het
Or5b101 T C 19: 13,004,994 (GRCm39) H233R probably benign Het
Or5b114-ps1 A T 19: 13,353,004 (GRCm39) N226I unknown Het
Or5p52 T A 7: 107,502,527 (GRCm39) I201N possibly damaging Het
Or7e175 T C 9: 20,048,757 (GRCm39) M115T probably damaging Het
Or8k1 T C 2: 86,047,247 (GRCm39) H269R probably damaging Het
Orai3 G T 7: 127,373,194 (GRCm39) A232S probably benign Het
Pak1ip1 G A 13: 41,162,727 (GRCm39) G177R probably benign Het
Pcp4l1 T C 1: 171,001,975 (GRCm39) R62G possibly damaging Het
Phox2b T A 5: 67,256,064 (GRCm39) Q74L probably benign Het
Pi4kb A G 3: 94,891,797 (GRCm39) Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxna1 T C 6: 89,306,541 (GRCm39) R1430G probably null Het
Plxna4 T C 6: 32,155,315 (GRCm39) H1543R probably benign Het
Prcc A T 3: 87,777,038 (GRCm39) F312Y probably damaging Het
Ranbp6 A G 19: 29,787,388 (GRCm39) L988P probably damaging Het
Rbm27 A G 18: 42,460,572 (GRCm39) T840A probably benign Het
Rchy1 G T 5: 92,105,831 (GRCm39) T39N probably benign Het
Rmi1 C T 13: 58,556,840 (GRCm39) T363I probably benign Het
Rnpc3 A C 3: 113,404,895 (GRCm39) I420S probably damaging Het
Rsph4a T A 10: 33,785,394 (GRCm39) V435E probably benign Het
Rwdd1 T C 10: 33,888,095 (GRCm39) T38A probably damaging Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Sel1l3 T C 5: 53,311,628 (GRCm39) Y619C probably damaging Het
Sf3b3 T C 8: 111,538,658 (GRCm39) T1121A probably damaging Het
Sgk3 T C 1: 9,942,534 (GRCm39) V102A probably benign Het
Sh2b1 T C 7: 126,068,354 (GRCm39) T486A probably damaging Het
Slc22a5 C T 11: 53,766,981 (GRCm39) R169H probably damaging Het
Slc4a5 T C 6: 83,266,223 (GRCm39) V889A possibly damaging Het
Spast C A 17: 74,646,069 (GRCm39) S13* probably null Het
Srek1 T C 13: 103,889,654 (GRCm39) probably null Het
Sugp1 G T 8: 70,509,220 (GRCm39) E164D probably benign Het
Synpo2 T C 3: 122,910,973 (GRCm39) D224G probably benign Het
Tanc1 A G 2: 59,630,432 (GRCm39) D804G probably damaging Het
Tep1 C T 14: 51,081,766 (GRCm39) C1228Y probably damaging Het
Tes T A 6: 17,100,341 (GRCm39) C325S probably benign Het
Themis T C 10: 28,739,390 (GRCm39) V620A probably benign Het
Trim17 T C 11: 58,862,257 (GRCm39) S430P probably damaging Het
Tubgcp5 T C 7: 55,445,693 (GRCm39) I65T possibly damaging Het
Unc13b T C 4: 43,171,955 (GRCm39) S928P unknown Het
Vat1l C T 8: 115,016,172 (GRCm39) A354V probably damaging Het
Vmn1r170 T A 7: 23,306,263 (GRCm39) S222T probably benign Het
Vmn2r112 A T 17: 22,820,213 (GRCm39) M29L probably benign Het
Vmn2r72 T C 7: 85,400,411 (GRCm39) I213V probably benign Het
Wdr89 T A 12: 75,679,564 (GRCm39) Q230L possibly damaging Het
Zfp386 A G 12: 116,023,283 (GRCm39) T334A probably benign Het
Zfp442 T A 2: 150,251,287 (GRCm39) H205L probably benign Het
Zfyve26 A T 12: 79,323,076 (GRCm39) I890N possibly damaging Het
Zic1 T C 9: 91,246,373 (GRCm39) E233G probably damaging Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31,790,593 (GRCm39) missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31,808,533 (GRCm39) missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31,804,668 (GRCm39) missense probably benign 0.07
IGL01086:Lamc3 APN 2 31,788,488 (GRCm39) missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31,802,119 (GRCm39) missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31,788,290 (GRCm39) missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31,777,667 (GRCm39) missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31,804,616 (GRCm39) splice site probably benign
IGL02340:Lamc3 APN 2 31,808,469 (GRCm39) missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31,795,977 (GRCm39) missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31,810,674 (GRCm39) missense probably benign 0.00
IGL02679:Lamc3 APN 2 31,835,410 (GRCm39) missense probably benign 0.01
IGL02751:Lamc3 APN 2 31,810,716 (GRCm39) missense probably benign 0.07
IGL02820:Lamc3 APN 2 31,813,034 (GRCm39) missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31,825,738 (GRCm39) splice site probably benign
IGL02926:Lamc3 APN 2 31,825,737 (GRCm39) splice site probably benign
IGL03090:Lamc3 APN 2 31,798,710 (GRCm39) splice site probably benign
IGL03258:Lamc3 APN 2 31,777,695 (GRCm39) missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31,812,440 (GRCm39) missense probably benign 0.07
R0137:Lamc3 UTSW 2 31,798,628 (GRCm39) missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31,805,096 (GRCm39) splice site probably benign
R0244:Lamc3 UTSW 2 31,830,733 (GRCm39) missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31,827,980 (GRCm39) missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31,818,814 (GRCm39) missense probably benign 0.03
R1142:Lamc3 UTSW 2 31,830,733 (GRCm39) missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31,818,859 (GRCm39) missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31,777,423 (GRCm39) missense probably benign
R1515:Lamc3 UTSW 2 31,830,763 (GRCm39) missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31,806,008 (GRCm39) missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31,811,793 (GRCm39) missense probably null 0.01
R1707:Lamc3 UTSW 2 31,802,141 (GRCm39) critical splice donor site probably null
R1714:Lamc3 UTSW 2 31,830,769 (GRCm39) missense probably benign 0.02
R1838:Lamc3 UTSW 2 31,815,594 (GRCm39) missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31,830,714 (GRCm39) missense probably benign 0.02
R3177:Lamc3 UTSW 2 31,798,637 (GRCm39) missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31,798,637 (GRCm39) missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31,814,604 (GRCm39) missense probably benign 0.01
R4065:Lamc3 UTSW 2 31,835,270 (GRCm39) missense probably benign 0.00
R4089:Lamc3 UTSW 2 31,810,520 (GRCm39) nonsense probably null
R4373:Lamc3 UTSW 2 31,788,244 (GRCm39) missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4395:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4397:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4746:Lamc3 UTSW 2 31,795,626 (GRCm39) missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31,830,748 (GRCm39) missense probably benign 0.02
R4960:Lamc3 UTSW 2 31,805,966 (GRCm39) missense probably benign 0.00
R5025:Lamc3 UTSW 2 31,798,681 (GRCm39) missense probably benign 0.13
R5062:Lamc3 UTSW 2 31,795,679 (GRCm39) missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31,777,356 (GRCm39) start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31,808,608 (GRCm39) missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31,821,997 (GRCm39) missense probably benign
R5655:Lamc3 UTSW 2 31,815,729 (GRCm39) missense probably benign 0.01
R5928:Lamc3 UTSW 2 31,811,721 (GRCm39) missense probably benign 0.00
R6018:Lamc3 UTSW 2 31,795,724 (GRCm39) missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31,777,413 (GRCm39) missense probably benign
R6601:Lamc3 UTSW 2 31,810,544 (GRCm39) missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31,798,701 (GRCm39) missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31,828,081 (GRCm39) missense probably benign
R7114:Lamc3 UTSW 2 31,820,657 (GRCm39) missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31,820,714 (GRCm39) missense probably benign 0.39
R7559:Lamc3 UTSW 2 31,812,380 (GRCm39) missense probably benign 0.00
R7714:Lamc3 UTSW 2 31,812,279 (GRCm39) splice site probably null
R7787:Lamc3 UTSW 2 31,790,551 (GRCm39) missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31,811,775 (GRCm39) missense probably benign
R8171:Lamc3 UTSW 2 31,804,983 (GRCm39) missense probably benign 0.06
R8208:Lamc3 UTSW 2 31,777,426 (GRCm39) missense possibly damaging 0.47
R8412:Lamc3 UTSW 2 31,802,128 (GRCm39) missense probably damaging 0.98
R9058:Lamc3 UTSW 2 31,798,653 (GRCm39) missense probably benign 0.01
R9242:Lamc3 UTSW 2 31,788,323 (GRCm39) missense probably benign 0.14
R9269:Lamc3 UTSW 2 31,813,017 (GRCm39) missense probably benign 0.11
X0010:Lamc3 UTSW 2 31,828,024 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACCCAGAGTGTCCCTGC -3'
(R):5'- ATATTACATGCCATTGACAGCG -3'

Sequencing Primer
(F):5'- CCAGAGTGTCCCTGCTGTTG -3'
(R):5'- CCATTGACAGCGGAGACTTG -3'
Posted On 2022-03-25