Incidental Mutation 'R9269:Zfp442'
ID 702728
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150409367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 205 (H205L)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect probably benign
Transcript: ENSMUST00000109916
AA Change: H205L

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: H205L

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: H204L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: H204L

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A C 15: 8,219,016 Q1683P probably damaging Het
A2m T C 6: 121,660,906 S845P probably benign Het
Actn1 T A 12: 80,172,971 N709Y probably benign Het
Alox5ap A G 5: 149,279,196 Y64C probably damaging Het
Anapc4 T A 5: 52,861,278 S521T possibly damaging Het
Ap3b1 C A 13: 94,404,062 P164Q probably damaging Het
Arhgef26 A G 3: 62,340,499 N335D probably damaging Het
Arrdc2 G A 8: 70,836,329 A354V probably benign Het
Atg2b A G 12: 105,652,100 S898P probably damaging Het
Atxn1 T A 13: 45,557,204 T751S probably benign Het
Begain T A 12: 109,033,193 R551W possibly damaging Het
Borcs8 C A 8: 70,141,871 D15E probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Card11 A T 5: 140,906,761 M183K probably damaging Het
Cldn3 T C 5: 134,986,725 L94P probably damaging Het
Clvs2 A T 10: 33,543,426 Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cop1 C T 1: 159,288,983 P409L probably benign Het
Crhbp C A 13: 95,436,516 A241S probably benign Het
Cyfip1 C A 7: 55,907,431 S794* probably null Het
D17Wsu92e A C 17: 27,786,075 Y169* probably null Het
Dlg5 T A 14: 24,192,813 H172L probably damaging Het
Doc2a T A 7: 126,850,987 I199N probably benign Het
Dock3 T C 9: 106,941,323 T1191A probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Fcgr1 C T 3: 96,285,838 R281H probably benign Het
Fndc10 T C 4: 155,694,748 V83A possibly damaging Het
Galnt2 T A 8: 124,338,463 I444K probably benign Het
Gcnt3 T C 9: 70,034,008 Y426C probably damaging Het
Gm5580 C T 6: 116,552,356 T398I probably damaging Het
Gtpbp1 C T 15: 79,717,654 R533C probably damaging Het
Hid1 T C 11: 115,361,676 E60G probably damaging Het
Ighv1-81 A T 12: 115,920,541 L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Klf10 A G 15: 38,297,758 L44P probably damaging Het
Lamc3 T C 2: 31,923,005 V1001A probably benign Het
Lamc3 C A 2: 31,928,896 S1211* probably null Het
Lmx1a T A 1: 167,830,625 H192Q probably benign Het
Nkx2-4 T C 2: 147,084,264 H226R possibly damaging Het
Olfr1046 T C 2: 86,216,903 H269R probably damaging Het
Olfr1179 G A 2: 88,402,242 R231C probably benign Het
Olfr1240 T A 2: 89,439,932 M116L probably damaging Het
Olfr1281 T C 2: 111,328,952 F178L probably damaging Het
Olfr1453 T C 19: 13,027,630 H233R probably benign Het
Olfr1468-ps1 A T 19: 13,375,640 N226I unknown Het
Olfr472 T A 7: 107,903,320 I201N possibly damaging Het
Olfr715 T C 7: 107,128,626 I256V probably benign Het
Olfr869 T C 9: 20,137,461 M115T probably damaging Het
Orai3 G T 7: 127,774,022 A232S probably benign Het
Pak1ip1 G A 13: 41,009,251 G177R probably benign Het
Pcp4l1 T C 1: 171,174,406 R62G possibly damaging Het
Phox2b T A 5: 67,098,721 Q74L probably benign Het
Pi4kb A G 3: 94,984,486 Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 T C 6: 89,329,559 R1430G probably null Het
Plxna4 T C 6: 32,178,380 H1543R probably benign Het
Prcc A T 3: 87,869,731 F312Y probably damaging Het
Ranbp6 A G 19: 29,809,988 L988P probably damaging Het
Rbm27 A G 18: 42,327,507 T840A probably benign Het
Rchy1 G T 5: 91,957,972 T39N probably benign Het
Rmi1 C T 13: 58,409,026 T363I probably benign Het
Rnpc3 A C 3: 113,611,246 I420S probably damaging Het
Rsph4a T A 10: 33,909,398 V435E probably benign Het
Rwdd1 T C 10: 34,012,099 T38A probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Sel1l3 T C 5: 53,154,286 Y619C probably damaging Het
Sf3b3 T C 8: 110,812,026 T1121A probably damaging Het
Sgk3 T C 1: 9,872,309 V102A probably benign Het
Sh2b1 T C 7: 126,469,182 T486A probably damaging Het
Slc22a5 C T 11: 53,876,155 R169H probably damaging Het
Slc4a5 T C 6: 83,289,241 V889A possibly damaging Het
Spast C A 17: 74,339,074 S13* probably null Het
Srek1 T C 13: 103,753,146 probably null Het
Sugp1 G T 8: 70,056,570 E164D probably benign Het
Synpo2 T C 3: 123,117,324 D224G probably benign Het
Tanc1 A G 2: 59,800,088 D804G probably damaging Het
Tep1 C T 14: 50,844,309 C1228Y probably damaging Het
Tes T A 6: 17,100,342 C325S probably benign Het
Themis T C 10: 28,863,394 V620A probably benign Het
Trim17 T C 11: 58,971,431 S430P probably damaging Het
Tubgcp5 T C 7: 55,795,945 I65T possibly damaging Het
Unc13b T C 4: 43,171,955 S928P unknown Het
Vat1l C T 8: 114,289,432 A354V probably damaging Het
Vmn1r170 T A 7: 23,606,838 S222T probably benign Het
Vmn2r112 A T 17: 22,601,232 M29L probably benign Het
Vmn2r72 T C 7: 85,751,203 I213V probably benign Het
Wdr89 T A 12: 75,632,790 Q230L possibly damaging Het
Zfp386 A G 12: 116,059,663 T334A probably benign Het
Zfyve26 A T 12: 79,276,302 I890N possibly damaging Het
Zic1 T C 9: 91,364,320 E233G probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150408748 missense unknown
R9711:Zfp442 UTSW 2 150408287 missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACATTGCTTACATTCATAGGG -3'
(R):5'- ACCCTCTGAATTTACTCAATGTGGT -3'

Sequencing Primer
(F):5'- ATTCATAGGGTTTCTCTCCAGTATG -3'
(R):5'- AAGTCTTTGCGTATCAGAGCC -3'
Posted On 2022-03-25