Incidental Mutation 'R9269:Arhgef26'
ID 702730
Institutional Source Beutler Lab
Gene Symbol Arhgef26
Ensembl Gene ENSMUSG00000036885
Gene Name Rho guanine nucleotide exchange factor 26
Synonyms 8430436L14Rik, 4631416L12Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 62245765-62369642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62247920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 335 (N335D)
Ref Sequence ENSEMBL: ENSMUSP00000078281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079300]
AlphaFold D3YYY8
Predicted Effect probably damaging
Transcript: ENSMUST00000079300
AA Change: N335D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: N335D

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
RhoGEF 441 620 1e-45 SMART
PH 654 782 4.04e-9 SMART
SH3 790 847 3.82e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,637,865 (GRCm39) S845P probably benign Het
Actn1 T A 12: 80,219,745 (GRCm39) N709Y probably benign Het
Alox5ap A G 5: 149,216,006 (GRCm39) Y64C probably damaging Het
Anapc4 T A 5: 53,018,620 (GRCm39) S521T possibly damaging Het
Ap3b1 C A 13: 94,540,570 (GRCm39) P164Q probably damaging Het
Arrdc2 G A 8: 71,288,973 (GRCm39) A354V probably benign Het
Atg2b A G 12: 105,618,359 (GRCm39) S898P probably damaging Het
Atxn1 T A 13: 45,710,680 (GRCm39) T751S probably benign Het
Begain T A 12: 108,999,119 (GRCm39) R551W possibly damaging Het
Borcs8 C A 8: 70,594,521 (GRCm39) D15E probably benign Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Card11 A T 5: 140,892,516 (GRCm39) M183K probably damaging Het
Cldn3 T C 5: 135,015,579 (GRCm39) L94P probably damaging Het
Clvs2 A T 10: 33,419,422 (GRCm39) Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cop1 C T 1: 159,116,553 (GRCm39) P409L probably benign Het
Cplane1 A C 15: 8,248,500 (GRCm39) Q1683P probably damaging Het
Crhbp C A 13: 95,573,024 (GRCm39) A241S probably benign Het
Cyfip1 C A 7: 55,557,179 (GRCm39) S794* probably null Het
Dlg5 T A 14: 24,242,881 (GRCm39) H172L probably damaging Het
Doc2a T A 7: 126,450,159 (GRCm39) I199N probably benign Het
Dock3 T C 9: 106,818,522 (GRCm39) T1191A probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Eif4a3l2 C T 6: 116,529,317 (GRCm39) T398I probably damaging Het
Fcgr1 C T 3: 96,193,154 (GRCm39) R281H probably benign Het
Fndc10 T C 4: 155,779,205 (GRCm39) V83A possibly damaging Het
Galnt2 T A 8: 125,065,202 (GRCm39) I444K probably benign Het
Gcnt3 T C 9: 69,941,290 (GRCm39) Y426C probably damaging Het
Gtpbp1 C T 15: 79,601,855 (GRCm39) R533C probably damaging Het
Hid1 T C 11: 115,252,502 (GRCm39) E60G probably damaging Het
Ighv1-81 A T 12: 115,884,161 (GRCm39) L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,618,565 (GRCm39) probably null Het
Ilrun A C 17: 28,005,049 (GRCm39) Y169* probably null Het
Klf10 A G 15: 38,298,002 (GRCm39) L44P probably damaging Het
Lamc3 T C 2: 31,813,017 (GRCm39) V1001A probably benign Het
Lamc3 C A 2: 31,818,908 (GRCm39) S1211* probably null Het
Lmx1a T A 1: 167,658,194 (GRCm39) H192Q probably benign Het
Nkx2-4 T C 2: 146,926,184 (GRCm39) H226R possibly damaging Het
Or2d2 T C 7: 106,727,833 (GRCm39) I256V probably benign Het
Or4a68 T A 2: 89,270,276 (GRCm39) M116L probably damaging Het
Or4k37 T C 2: 111,159,297 (GRCm39) F178L probably damaging Het
Or4p18 G A 2: 88,232,586 (GRCm39) R231C probably benign Het
Or5b101 T C 19: 13,004,994 (GRCm39) H233R probably benign Het
Or5b114-ps1 A T 19: 13,353,004 (GRCm39) N226I unknown Het
Or5p52 T A 7: 107,502,527 (GRCm39) I201N possibly damaging Het
Or7e175 T C 9: 20,048,757 (GRCm39) M115T probably damaging Het
Or8k1 T C 2: 86,047,247 (GRCm39) H269R probably damaging Het
Orai3 G T 7: 127,373,194 (GRCm39) A232S probably benign Het
Pak1ip1 G A 13: 41,162,727 (GRCm39) G177R probably benign Het
Pcp4l1 T C 1: 171,001,975 (GRCm39) R62G possibly damaging Het
Phox2b T A 5: 67,256,064 (GRCm39) Q74L probably benign Het
Pi4kb A G 3: 94,891,797 (GRCm39) Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxna1 T C 6: 89,306,541 (GRCm39) R1430G probably null Het
Plxna4 T C 6: 32,155,315 (GRCm39) H1543R probably benign Het
Prcc A T 3: 87,777,038 (GRCm39) F312Y probably damaging Het
Ranbp6 A G 19: 29,787,388 (GRCm39) L988P probably damaging Het
Rbm27 A G 18: 42,460,572 (GRCm39) T840A probably benign Het
Rchy1 G T 5: 92,105,831 (GRCm39) T39N probably benign Het
Rmi1 C T 13: 58,556,840 (GRCm39) T363I probably benign Het
Rnpc3 A C 3: 113,404,895 (GRCm39) I420S probably damaging Het
Rsph4a T A 10: 33,785,394 (GRCm39) V435E probably benign Het
Rwdd1 T C 10: 33,888,095 (GRCm39) T38A probably damaging Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Sel1l3 T C 5: 53,311,628 (GRCm39) Y619C probably damaging Het
Sf3b3 T C 8: 111,538,658 (GRCm39) T1121A probably damaging Het
Sgk3 T C 1: 9,942,534 (GRCm39) V102A probably benign Het
Sh2b1 T C 7: 126,068,354 (GRCm39) T486A probably damaging Het
Slc22a5 C T 11: 53,766,981 (GRCm39) R169H probably damaging Het
Slc4a5 T C 6: 83,266,223 (GRCm39) V889A possibly damaging Het
Spast C A 17: 74,646,069 (GRCm39) S13* probably null Het
Srek1 T C 13: 103,889,654 (GRCm39) probably null Het
Sugp1 G T 8: 70,509,220 (GRCm39) E164D probably benign Het
Synpo2 T C 3: 122,910,973 (GRCm39) D224G probably benign Het
Tanc1 A G 2: 59,630,432 (GRCm39) D804G probably damaging Het
Tep1 C T 14: 51,081,766 (GRCm39) C1228Y probably damaging Het
Tes T A 6: 17,100,341 (GRCm39) C325S probably benign Het
Themis T C 10: 28,739,390 (GRCm39) V620A probably benign Het
Trim17 T C 11: 58,862,257 (GRCm39) S430P probably damaging Het
Tubgcp5 T C 7: 55,445,693 (GRCm39) I65T possibly damaging Het
Unc13b T C 4: 43,171,955 (GRCm39) S928P unknown Het
Vat1l C T 8: 115,016,172 (GRCm39) A354V probably damaging Het
Vmn1r170 T A 7: 23,306,263 (GRCm39) S222T probably benign Het
Vmn2r112 A T 17: 22,820,213 (GRCm39) M29L probably benign Het
Vmn2r72 T C 7: 85,400,411 (GRCm39) I213V probably benign Het
Wdr89 T A 12: 75,679,564 (GRCm39) Q230L possibly damaging Het
Zfp386 A G 12: 116,023,283 (GRCm39) T334A probably benign Het
Zfp442 T A 2: 150,251,287 (GRCm39) H205L probably benign Het
Zfyve26 A T 12: 79,323,076 (GRCm39) I890N possibly damaging Het
Zic1 T C 9: 91,246,373 (GRCm39) E233G probably damaging Het
Other mutations in Arhgef26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Arhgef26 APN 3 62,247,804 (GRCm39) missense probably benign
IGL01060:Arhgef26 APN 3 62,247,542 (GRCm39) missense probably benign 0.44
IGL01942:Arhgef26 APN 3 62,247,515 (GRCm39) missense probably benign 0.03
IGL02085:Arhgef26 APN 3 62,367,145 (GRCm39) intron probably benign
IGL02172:Arhgef26 APN 3 62,367,097 (GRCm39) missense probably benign 0.03
IGL03017:Arhgef26 APN 3 62,355,702 (GRCm39) missense possibly damaging 0.46
IGL03101:Arhgef26 APN 3 62,327,082 (GRCm39) missense possibly damaging 0.95
IGL03296:Arhgef26 APN 3 62,330,926 (GRCm39) missense probably damaging 1.00
IGL03401:Arhgef26 APN 3 62,330,953 (GRCm39) missense possibly damaging 0.95
R0138:Arhgef26 UTSW 3 62,355,680 (GRCm39) missense probably benign 0.06
R0140:Arhgef26 UTSW 3 62,355,666 (GRCm39) missense probably benign 0.02
R0152:Arhgef26 UTSW 3 62,330,965 (GRCm39) missense probably damaging 0.99
R0157:Arhgef26 UTSW 3 62,288,392 (GRCm39) missense probably damaging 1.00
R0308:Arhgef26 UTSW 3 62,247,820 (GRCm39) missense probably benign 0.01
R0317:Arhgef26 UTSW 3 62,330,965 (GRCm39) missense probably damaging 0.99
R0529:Arhgef26 UTSW 3 62,247,146 (GRCm39) missense probably benign
R0825:Arhgef26 UTSW 3 62,334,014 (GRCm39) missense probably damaging 0.97
R1331:Arhgef26 UTSW 3 62,247,449 (GRCm39) missense probably benign 0.00
R1333:Arhgef26 UTSW 3 62,247,744 (GRCm39) missense probably benign 0.04
R1351:Arhgef26 UTSW 3 62,288,262 (GRCm39) missense probably damaging 1.00
R1740:Arhgef26 UTSW 3 62,331,004 (GRCm39) missense probably damaging 1.00
R2121:Arhgef26 UTSW 3 62,247,704 (GRCm39) missense probably damaging 0.96
R2404:Arhgef26 UTSW 3 62,336,336 (GRCm39) missense possibly damaging 0.90
R2437:Arhgef26 UTSW 3 62,340,002 (GRCm39) missense probably damaging 0.96
R2939:Arhgef26 UTSW 3 62,288,331 (GRCm39) missense possibly damaging 0.72
R3084:Arhgef26 UTSW 3 62,285,037 (GRCm39) missense probably benign 0.19
R3712:Arhgef26 UTSW 3 62,331,050 (GRCm39) missense probably damaging 1.00
R4005:Arhgef26 UTSW 3 62,247,816 (GRCm39) missense probably benign
R4225:Arhgef26 UTSW 3 62,288,343 (GRCm39) missense probably benign 0.00
R4635:Arhgef26 UTSW 3 62,247,861 (GRCm39) missense probably damaging 1.00
R4961:Arhgef26 UTSW 3 62,367,046 (GRCm39) missense probably damaging 1.00
R4989:Arhgef26 UTSW 3 62,247,806 (GRCm39) missense possibly damaging 0.94
R5249:Arhgef26 UTSW 3 62,247,981 (GRCm39) missense probably damaging 1.00
R5284:Arhgef26 UTSW 3 62,327,052 (GRCm39) missense probably damaging 0.99
R5661:Arhgef26 UTSW 3 62,285,075 (GRCm39) splice site probably benign
R5970:Arhgef26 UTSW 3 62,247,468 (GRCm39) missense probably benign
R6022:Arhgef26 UTSW 3 62,336,360 (GRCm39) missense probably damaging 1.00
R6193:Arhgef26 UTSW 3 62,247,213 (GRCm39) missense possibly damaging 0.49
R6247:Arhgef26 UTSW 3 62,288,381 (GRCm39) missense probably damaging 1.00
R6434:Arhgef26 UTSW 3 62,336,335 (GRCm39) missense probably damaging 0.99
R6827:Arhgef26 UTSW 3 62,330,919 (GRCm39) splice site probably null
R7111:Arhgef26 UTSW 3 62,252,689 (GRCm39) missense possibly damaging 0.90
R7128:Arhgef26 UTSW 3 62,326,971 (GRCm39) missense possibly damaging 0.94
R7360:Arhgef26 UTSW 3 62,355,626 (GRCm39) missense possibly damaging 0.63
R7456:Arhgef26 UTSW 3 62,247,476 (GRCm39) missense probably benign 0.00
R8039:Arhgef26 UTSW 3 62,247,351 (GRCm39) missense probably benign 0.32
R8120:Arhgef26 UTSW 3 62,248,796 (GRCm39) missense probably damaging 1.00
R8511:Arhgef26 UTSW 3 62,336,350 (GRCm39) missense probably damaging 0.98
R8887:Arhgef26 UTSW 3 62,247,401 (GRCm39) missense probably benign 0.04
R8979:Arhgef26 UTSW 3 62,246,969 (GRCm39) missense possibly damaging 0.78
R8993:Arhgef26 UTSW 3 62,355,525 (GRCm39) missense probably benign 0.43
R9213:Arhgef26 UTSW 3 62,340,000 (GRCm39) missense probably benign 0.03
R9712:Arhgef26 UTSW 3 62,331,034 (GRCm39) missense probably damaging 1.00
R9776:Arhgef26 UTSW 3 62,246,803 (GRCm39) start gained probably benign
Z1177:Arhgef26 UTSW 3 62,247,351 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CCCATAGGAGGCTTCTCAAG -3'
(R):5'- ATAGAAAGCAATGCACTGTTCCATG -3'

Sequencing Primer
(F):5'- ATAGGAGGCTTCTCAAGGTGCG -3'
(R):5'- GCAATGCACTGTTCCATGATTTG -3'
Posted On 2022-03-25