Incidental Mutation 'R9269:Fcgr1'
ID 702734
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene Name Fc receptor, IgG, high affinity I
Synonyms CD64, FcgammaRI
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 96190225-96201285 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96193154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 281 (R281H)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
AlphaFold P26151
Predicted Effect probably benign
Transcript: ENSMUST00000029748
AA Change: R281H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: R281H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,637,865 (GRCm39) S845P probably benign Het
Actn1 T A 12: 80,219,745 (GRCm39) N709Y probably benign Het
Alox5ap A G 5: 149,216,006 (GRCm39) Y64C probably damaging Het
Anapc4 T A 5: 53,018,620 (GRCm39) S521T possibly damaging Het
Ap3b1 C A 13: 94,540,570 (GRCm39) P164Q probably damaging Het
Arhgef26 A G 3: 62,247,920 (GRCm39) N335D probably damaging Het
Arrdc2 G A 8: 71,288,973 (GRCm39) A354V probably benign Het
Atg2b A G 12: 105,618,359 (GRCm39) S898P probably damaging Het
Atxn1 T A 13: 45,710,680 (GRCm39) T751S probably benign Het
Begain T A 12: 108,999,119 (GRCm39) R551W possibly damaging Het
Borcs8 C A 8: 70,594,521 (GRCm39) D15E probably benign Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Card11 A T 5: 140,892,516 (GRCm39) M183K probably damaging Het
Cldn3 T C 5: 135,015,579 (GRCm39) L94P probably damaging Het
Clvs2 A T 10: 33,419,422 (GRCm39) Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cop1 C T 1: 159,116,553 (GRCm39) P409L probably benign Het
Cplane1 A C 15: 8,248,500 (GRCm39) Q1683P probably damaging Het
Crhbp C A 13: 95,573,024 (GRCm39) A241S probably benign Het
Cyfip1 C A 7: 55,557,179 (GRCm39) S794* probably null Het
Dlg5 T A 14: 24,242,881 (GRCm39) H172L probably damaging Het
Doc2a T A 7: 126,450,159 (GRCm39) I199N probably benign Het
Dock3 T C 9: 106,818,522 (GRCm39) T1191A probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Eif4a3l2 C T 6: 116,529,317 (GRCm39) T398I probably damaging Het
Fndc10 T C 4: 155,779,205 (GRCm39) V83A possibly damaging Het
Galnt2 T A 8: 125,065,202 (GRCm39) I444K probably benign Het
Gcnt3 T C 9: 69,941,290 (GRCm39) Y426C probably damaging Het
Gtpbp1 C T 15: 79,601,855 (GRCm39) R533C probably damaging Het
Hid1 T C 11: 115,252,502 (GRCm39) E60G probably damaging Het
Ighv1-81 A T 12: 115,884,161 (GRCm39) L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,618,565 (GRCm39) probably null Het
Ilrun A C 17: 28,005,049 (GRCm39) Y169* probably null Het
Klf10 A G 15: 38,298,002 (GRCm39) L44P probably damaging Het
Lamc3 T C 2: 31,813,017 (GRCm39) V1001A probably benign Het
Lamc3 C A 2: 31,818,908 (GRCm39) S1211* probably null Het
Lmx1a T A 1: 167,658,194 (GRCm39) H192Q probably benign Het
Nkx2-4 T C 2: 146,926,184 (GRCm39) H226R possibly damaging Het
Or2d2 T C 7: 106,727,833 (GRCm39) I256V probably benign Het
Or4a68 T A 2: 89,270,276 (GRCm39) M116L probably damaging Het
Or4k37 T C 2: 111,159,297 (GRCm39) F178L probably damaging Het
Or4p18 G A 2: 88,232,586 (GRCm39) R231C probably benign Het
Or5b101 T C 19: 13,004,994 (GRCm39) H233R probably benign Het
Or5b114-ps1 A T 19: 13,353,004 (GRCm39) N226I unknown Het
Or5p52 T A 7: 107,502,527 (GRCm39) I201N possibly damaging Het
Or7e175 T C 9: 20,048,757 (GRCm39) M115T probably damaging Het
Or8k1 T C 2: 86,047,247 (GRCm39) H269R probably damaging Het
Orai3 G T 7: 127,373,194 (GRCm39) A232S probably benign Het
Pak1ip1 G A 13: 41,162,727 (GRCm39) G177R probably benign Het
Pcp4l1 T C 1: 171,001,975 (GRCm39) R62G possibly damaging Het
Phox2b T A 5: 67,256,064 (GRCm39) Q74L probably benign Het
Pi4kb A G 3: 94,891,797 (GRCm39) Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxna1 T C 6: 89,306,541 (GRCm39) R1430G probably null Het
Plxna4 T C 6: 32,155,315 (GRCm39) H1543R probably benign Het
Prcc A T 3: 87,777,038 (GRCm39) F312Y probably damaging Het
Ranbp6 A G 19: 29,787,388 (GRCm39) L988P probably damaging Het
Rbm27 A G 18: 42,460,572 (GRCm39) T840A probably benign Het
Rchy1 G T 5: 92,105,831 (GRCm39) T39N probably benign Het
Rmi1 C T 13: 58,556,840 (GRCm39) T363I probably benign Het
Rnpc3 A C 3: 113,404,895 (GRCm39) I420S probably damaging Het
Rsph4a T A 10: 33,785,394 (GRCm39) V435E probably benign Het
Rwdd1 T C 10: 33,888,095 (GRCm39) T38A probably damaging Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Sel1l3 T C 5: 53,311,628 (GRCm39) Y619C probably damaging Het
Sf3b3 T C 8: 111,538,658 (GRCm39) T1121A probably damaging Het
Sgk3 T C 1: 9,942,534 (GRCm39) V102A probably benign Het
Sh2b1 T C 7: 126,068,354 (GRCm39) T486A probably damaging Het
Slc22a5 C T 11: 53,766,981 (GRCm39) R169H probably damaging Het
Slc4a5 T C 6: 83,266,223 (GRCm39) V889A possibly damaging Het
Spast C A 17: 74,646,069 (GRCm39) S13* probably null Het
Srek1 T C 13: 103,889,654 (GRCm39) probably null Het
Sugp1 G T 8: 70,509,220 (GRCm39) E164D probably benign Het
Synpo2 T C 3: 122,910,973 (GRCm39) D224G probably benign Het
Tanc1 A G 2: 59,630,432 (GRCm39) D804G probably damaging Het
Tep1 C T 14: 51,081,766 (GRCm39) C1228Y probably damaging Het
Tes T A 6: 17,100,341 (GRCm39) C325S probably benign Het
Themis T C 10: 28,739,390 (GRCm39) V620A probably benign Het
Trim17 T C 11: 58,862,257 (GRCm39) S430P probably damaging Het
Tubgcp5 T C 7: 55,445,693 (GRCm39) I65T possibly damaging Het
Unc13b T C 4: 43,171,955 (GRCm39) S928P unknown Het
Vat1l C T 8: 115,016,172 (GRCm39) A354V probably damaging Het
Vmn1r170 T A 7: 23,306,263 (GRCm39) S222T probably benign Het
Vmn2r112 A T 17: 22,820,213 (GRCm39) M29L probably benign Het
Vmn2r72 T C 7: 85,400,411 (GRCm39) I213V probably benign Het
Wdr89 T A 12: 75,679,564 (GRCm39) Q230L possibly damaging Het
Zfp386 A G 12: 116,023,283 (GRCm39) T334A probably benign Het
Zfp442 T A 2: 150,251,287 (GRCm39) H205L probably benign Het
Zfyve26 A T 12: 79,323,076 (GRCm39) I890N possibly damaging Het
Zic1 T C 9: 91,246,373 (GRCm39) E233G probably damaging Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96,191,686 (GRCm39) missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96,191,893 (GRCm39) missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96,191,814 (GRCm39) nonsense probably null
F5770:Fcgr1 UTSW 3 96,191,592 (GRCm39) makesense probably null
FR4737:Fcgr1 UTSW 3 96,194,410 (GRCm39) missense probably benign 0.01
FR4737:Fcgr1 UTSW 3 96,191,820 (GRCm39) frame shift probably null
R0323:Fcgr1 UTSW 3 96,193,145 (GRCm39) missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96,199,628 (GRCm39) missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96,199,682 (GRCm39) missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96,194,386 (GRCm39) missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96,194,386 (GRCm39) missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96,193,184 (GRCm39) missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96,193,233 (GRCm39) missense possibly damaging 0.88
R3941:Fcgr1 UTSW 3 96,193,349 (GRCm39) missense probably benign 0.13
R4004:Fcgr1 UTSW 3 96,191,668 (GRCm39) missense probably benign 0.00
R4409:Fcgr1 UTSW 3 96,191,893 (GRCm39) missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96,194,302 (GRCm39) missense probably damaging 0.99
R5047:Fcgr1 UTSW 3 96,193,200 (GRCm39) missense probably benign 0.38
R6970:Fcgr1 UTSW 3 96,191,936 (GRCm39) critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96,191,615 (GRCm39) missense not run
R7992:Fcgr1 UTSW 3 96,191,897 (GRCm39) missense probably benign 0.23
R8554:Fcgr1 UTSW 3 96,199,788 (GRCm39) missense probably damaging 1.00
R9396:Fcgr1 UTSW 3 96,194,390 (GRCm39) nonsense probably null
V7581:Fcgr1 UTSW 3 96,191,592 (GRCm39) makesense probably null
V7582:Fcgr1 UTSW 3 96,191,592 (GRCm39) makesense probably null
V7583:Fcgr1 UTSW 3 96,191,592 (GRCm39) makesense probably null
X0028:Fcgr1 UTSW 3 96,193,343 (GRCm39) missense probably benign 0.29
Predicted Primers
Posted On 2022-03-25