Mutagenetix > Incidental Mutation

Incidental Mutation 'R9269:Plxna4'

702748

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

Accession Numbers

Genbank: NM_175750

Essential gene?

Possibly non essential (E-score: 0.418) question?

Stock #

R9269 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32178380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1543 (H1543R)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

AlphaFold

Q80UG2

Predicted Effect

probably benign
Transcript: ENSMUST00000115096
AA Change: H1543R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: H1543R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	C	15: 8,219,016	Q1683P	probably damaging	Het
A2m	T	C	6: 121,660,906	S845P	probably benign	Het
Actn1	T	A	12: 80,172,971	N709Y	probably benign	Het
Alox5ap	A	G	5: 149,279,196	Y64C	probably damaging	Het
Anapc4	T	A	5: 52,861,278	S521T	possibly damaging	Het
Ap3b1	C	A	13: 94,404,062	P164Q	probably damaging	Het
Arhgef26	A	G	3: 62,340,499	N335D	probably damaging	Het
Arrdc2	G	A	8: 70,836,329	A354V	probably benign	Het
Atg2b	A	G	12: 105,652,100	S898P	probably damaging	Het
Atxn1	T	A	13: 45,557,204	T751S	probably benign	Het
Begain	T	A	12: 109,033,193	R551W	possibly damaging	Het
Borcs8	C	A	8: 70,141,871	D15E	probably benign	Het
Btbd16	C	T	7: 130,815,786	R344C	probably damaging	Het
Card11	A	T	5: 140,906,761	M183K	probably damaging	Het
Cldn3	T	C	5: 134,986,725	L94P	probably damaging	Het
Clvs2	A	T	10: 33,543,426	Y211N	probably damaging	Het
Col15a1	G	C	4: 47,288,200		probably benign	Het
Cop1	C	T	1: 159,288,983	P409L	probably benign	Het
Crhbp	C	A	13: 95,436,516	A241S	probably benign	Het
Cyfip1	C	A	7: 55,907,431	S794*	probably null	Het
D17Wsu92e	A	C	17: 27,786,075	Y169*	probably null	Het
Dlg5	T	A	14: 24,192,813	H172L	probably damaging	Het
Doc2a	T	A	7: 126,850,987	I199N	probably benign	Het
Dock3	T	C	9: 106,941,323	T1191A	probably benign	Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Fcgr1	C	T	3: 96,285,838	R281H	probably benign	Het
Fndc10	T	C	4: 155,694,748	V83A	possibly damaging	Het
Galnt2	T	A	8: 124,338,463	I444K	probably benign	Het
Gcnt3	T	C	9: 70,034,008	Y426C	probably damaging	Het
Gm5580	C	T	6: 116,552,356	T398I	probably damaging	Het
Gtpbp1	C	T	15: 79,717,654	R533C	probably damaging	Het
Hid1	T	C	11: 115,361,676	E60G	probably damaging	Het
Ighv1-81	A	T	12: 115,920,541	L30Q	possibly damaging	Het
Ighv5-8	TATATATATATATATATATATA	TATATATATATATATATATATATA	12: 113,654,945		probably null	Het
Klf10	A	G	15: 38,297,758	L44P	probably damaging	Het
Lamc3	T	C	2: 31,923,005	V1001A	probably benign	Het
Lamc3	C	A	2: 31,928,896	S1211*	probably null	Het
Lmx1a	T	A	1: 167,830,625	H192Q	probably benign	Het
Nkx2-4	T	C	2: 147,084,264	H226R	possibly damaging	Het
Olfr1046	T	C	2: 86,216,903	H269R	probably damaging	Het
Olfr1179	G	A	2: 88,402,242	R231C	probably benign	Het
Olfr1240	T	A	2: 89,439,932	M116L	probably damaging	Het
Olfr1281	T	C	2: 111,328,952	F178L	probably damaging	Het
Olfr1453	T	C	19: 13,027,630	H233R	probably benign	Het
Olfr1468-ps1	A	T	19: 13,375,640	N226I	unknown	Het
Olfr472	T	A	7: 107,903,320	I201N	possibly damaging	Het
Olfr715	T	C	7: 107,128,626	I256V	probably benign	Het
Olfr869	T	C	9: 20,137,461	M115T	probably damaging	Het
Orai3	G	T	7: 127,774,022	A232S	probably benign	Het
Pak1ip1	G	A	13: 41,009,251	G177R	probably benign	Het
Pcp4l1	T	C	1: 171,174,406	R62G	possibly damaging	Het
Phox2b	T	A	5: 67,098,721	Q74L	probably benign	Het
Pi4kb	A	G	3: 94,984,486	Y159C	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plxna1	T	C	6: 89,329,559	R1430G	probably null	Het
Prcc	A	T	3: 87,869,731	F312Y	probably damaging	Het
Ranbp6	A	G	19: 29,809,988	L988P	probably damaging	Het
Rbm27	A	G	18: 42,327,507	T840A	probably benign	Het
Rchy1	G	T	5: 91,957,972	T39N	probably benign	Het
Rmi1	C	T	13: 58,409,026	T363I	probably benign	Het
Rnpc3	A	C	3: 113,611,246	I420S	probably damaging	Het
Rsph4a	T	A	10: 33,909,398	V435E	probably benign	Het
Rwdd1	T	C	10: 34,012,099	T38A	probably damaging	Het
S100a13	G	T	3: 90,515,863	D54Y	unknown	Het
Sel1l3	T	C	5: 53,154,286	Y619C	probably damaging	Het
Sf3b3	T	C	8: 110,812,026	T1121A	probably damaging	Het
Sgk3	T	C	1: 9,872,309	V102A	probably benign	Het
Sh2b1	T	C	7: 126,469,182	T486A	probably damaging	Het
Slc22a5	C	T	11: 53,876,155	R169H	probably damaging	Het
Slc4a5	T	C	6: 83,289,241	V889A	possibly damaging	Het
Spast	C	A	17: 74,339,074	S13*	probably null	Het
Srek1	T	C	13: 103,753,146		probably null	Het
Sugp1	G	T	8: 70,056,570	E164D	probably benign	Het
Synpo2	T	C	3: 123,117,324	D224G	probably benign	Het
Tanc1	A	G	2: 59,800,088	D804G	probably damaging	Het
Tep1	C	T	14: 50,844,309	C1228Y	probably damaging	Het
Tes	T	A	6: 17,100,342	C325S	probably benign	Het
Themis	T	C	10: 28,863,394	V620A	probably benign	Het
Trim17	T	C	11: 58,971,431	S430P	probably damaging	Het
Tubgcp5	T	C	7: 55,795,945	I65T	possibly damaging	Het
Unc13b	T	C	4: 43,171,955	S928P	unknown	Het
Vat1l	C	T	8: 114,289,432	A354V	probably damaging	Het
Vmn1r170	T	A	7: 23,606,838	S222T	probably benign	Het
Vmn2r112	A	T	17: 22,601,232	M29L	probably benign	Het
Vmn2r72	T	C	7: 85,751,203	I213V	probably benign	Het
Wdr89	T	A	12: 75,632,790	Q230L	possibly damaging	Het
Zfp386	A	G	12: 116,059,663	T334A	probably benign	Het
Zfp442	T	A	2: 150,409,367	H205L	probably benign	Het
Zfyve26	A	T	12: 79,276,302	I890N	possibly damaging	Het
Zic1	T	C	9: 91,364,320	E233G	probably damaging	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
corona	UTSW	6	32517264	missense	probably damaging	1.00
Disposed	UTSW	6	32516505	missense	probably damaging	1.00
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0308:Plxna4	UTSW	6	32237768	missense	probably benign	0.01
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0542:Plxna4	UTSW	6	32192297	missense	probably damaging	1.00
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1569:Plxna4	UTSW	6	32185475	missense	possibly damaging	0.78
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4701:Plxna4	UTSW	6	32516688	missense	probably damaging	0.99
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	splice site	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7046:Plxna4	UTSW	6	32516505	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
R8167:Plxna4	UTSW	6	32517046	missense	probably damaging	0.99
R8191:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R8225:Plxna4	UTSW	6	32162103	missense	probably damaging	1.00
R8284:Plxna4	UTSW	6	32152854	missense	probably benign	0.25
R8305:Plxna4	UTSW	6	32211065	missense	possibly damaging	0.81
R8438:Plxna4	UTSW	6	32202180	missense	probably damaging	1.00
R8493:Plxna4	UTSW	6	32215712	missense	probably benign	0.27
R8714:Plxna4	UTSW	6	32163444	nonsense	probably null
R8759:Plxna4	UTSW	6	32192341	missense	probably damaging	1.00
R8822:Plxna4	UTSW	6	32150496	missense	possibly damaging	0.89
R8844:Plxna4	UTSW	6	32197091	missense	probably benign	0.11
R8974:Plxna4	UTSW	6	32239512	missense	possibly damaging	0.79
R9020:Plxna4	UTSW	6	32234562	missense	possibly damaging	0.90
R9144:Plxna4	UTSW	6	32185561	missense	possibly damaging	0.77
R9206:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9208:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9257:Plxna4	UTSW	6	32162083	missense	probably damaging	0.99
R9411:Plxna4	UTSW	6	32182747	missense	probably damaging	1.00
R9469:Plxna4	UTSW	6	32517591	missense	probably benign
R9583:Plxna4	UTSW	6	32215234	missense	possibly damaging	0.78
R9647:Plxna4	UTSW	6	32251109	missense	probably damaging	1.00
R9695:Plxna4	UTSW	6	32206121	missense	probably benign	0.02
R9801:Plxna4	UTSW	6	32163591	critical splice acceptor site	probably null
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGAGGCTCACGGAACCTG -3'
(R):5'- TCTGGGAGCCCTTCCTATTG -3'

Sequencing Primer
(F):5'- CCAATTCCAAGGAGACTGTAAAGGC -3'
(R):5'- GGGAGCCCTTCCTATTGTCCTC -3'

Posted On

2022-03-25