Incidental Mutation 'R9269:Plxna4'
ID 702748
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Name plexin A4
Synonyms Plxa4
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.600) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 32121478-32565127 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32155315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1543 (H1543R)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
AlphaFold Q80UG2
Predicted Effect probably benign
Transcript: ENSMUST00000115096
AA Change: H1543R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: H1543R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,637,865 (GRCm39) S845P probably benign Het
Actn1 T A 12: 80,219,745 (GRCm39) N709Y probably benign Het
Alox5ap A G 5: 149,216,006 (GRCm39) Y64C probably damaging Het
Anapc4 T A 5: 53,018,620 (GRCm39) S521T possibly damaging Het
Ap3b1 C A 13: 94,540,570 (GRCm39) P164Q probably damaging Het
Arhgef26 A G 3: 62,247,920 (GRCm39) N335D probably damaging Het
Arrdc2 G A 8: 71,288,973 (GRCm39) A354V probably benign Het
Atg2b A G 12: 105,618,359 (GRCm39) S898P probably damaging Het
Atxn1 T A 13: 45,710,680 (GRCm39) T751S probably benign Het
Begain T A 12: 108,999,119 (GRCm39) R551W possibly damaging Het
Borcs8 C A 8: 70,594,521 (GRCm39) D15E probably benign Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Card11 A T 5: 140,892,516 (GRCm39) M183K probably damaging Het
Cldn3 T C 5: 135,015,579 (GRCm39) L94P probably damaging Het
Clvs2 A T 10: 33,419,422 (GRCm39) Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cop1 C T 1: 159,116,553 (GRCm39) P409L probably benign Het
Cplane1 A C 15: 8,248,500 (GRCm39) Q1683P probably damaging Het
Crhbp C A 13: 95,573,024 (GRCm39) A241S probably benign Het
Cyfip1 C A 7: 55,557,179 (GRCm39) S794* probably null Het
Dlg5 T A 14: 24,242,881 (GRCm39) H172L probably damaging Het
Doc2a T A 7: 126,450,159 (GRCm39) I199N probably benign Het
Dock3 T C 9: 106,818,522 (GRCm39) T1191A probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Eif4a3l2 C T 6: 116,529,317 (GRCm39) T398I probably damaging Het
Fcgr1 C T 3: 96,193,154 (GRCm39) R281H probably benign Het
Fndc10 T C 4: 155,779,205 (GRCm39) V83A possibly damaging Het
Galnt2 T A 8: 125,065,202 (GRCm39) I444K probably benign Het
Gcnt3 T C 9: 69,941,290 (GRCm39) Y426C probably damaging Het
Gtpbp1 C T 15: 79,601,855 (GRCm39) R533C probably damaging Het
Hid1 T C 11: 115,252,502 (GRCm39) E60G probably damaging Het
Ighv1-81 A T 12: 115,884,161 (GRCm39) L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,618,565 (GRCm39) probably null Het
Ilrun A C 17: 28,005,049 (GRCm39) Y169* probably null Het
Klf10 A G 15: 38,298,002 (GRCm39) L44P probably damaging Het
Lamc3 T C 2: 31,813,017 (GRCm39) V1001A probably benign Het
Lamc3 C A 2: 31,818,908 (GRCm39) S1211* probably null Het
Lmx1a T A 1: 167,658,194 (GRCm39) H192Q probably benign Het
Nkx2-4 T C 2: 146,926,184 (GRCm39) H226R possibly damaging Het
Or2d2 T C 7: 106,727,833 (GRCm39) I256V probably benign Het
Or4a68 T A 2: 89,270,276 (GRCm39) M116L probably damaging Het
Or4k37 T C 2: 111,159,297 (GRCm39) F178L probably damaging Het
Or4p18 G A 2: 88,232,586 (GRCm39) R231C probably benign Het
Or5b101 T C 19: 13,004,994 (GRCm39) H233R probably benign Het
Or5b114-ps1 A T 19: 13,353,004 (GRCm39) N226I unknown Het
Or5p52 T A 7: 107,502,527 (GRCm39) I201N possibly damaging Het
Or7e175 T C 9: 20,048,757 (GRCm39) M115T probably damaging Het
Or8k1 T C 2: 86,047,247 (GRCm39) H269R probably damaging Het
Orai3 G T 7: 127,373,194 (GRCm39) A232S probably benign Het
Pak1ip1 G A 13: 41,162,727 (GRCm39) G177R probably benign Het
Pcp4l1 T C 1: 171,001,975 (GRCm39) R62G possibly damaging Het
Phox2b T A 5: 67,256,064 (GRCm39) Q74L probably benign Het
Pi4kb A G 3: 94,891,797 (GRCm39) Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxna1 T C 6: 89,306,541 (GRCm39) R1430G probably null Het
Prcc A T 3: 87,777,038 (GRCm39) F312Y probably damaging Het
Ranbp6 A G 19: 29,787,388 (GRCm39) L988P probably damaging Het
Rbm27 A G 18: 42,460,572 (GRCm39) T840A probably benign Het
Rchy1 G T 5: 92,105,831 (GRCm39) T39N probably benign Het
Rmi1 C T 13: 58,556,840 (GRCm39) T363I probably benign Het
Rnpc3 A C 3: 113,404,895 (GRCm39) I420S probably damaging Het
Rsph4a T A 10: 33,785,394 (GRCm39) V435E probably benign Het
Rwdd1 T C 10: 33,888,095 (GRCm39) T38A probably damaging Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Sel1l3 T C 5: 53,311,628 (GRCm39) Y619C probably damaging Het
Sf3b3 T C 8: 111,538,658 (GRCm39) T1121A probably damaging Het
Sgk3 T C 1: 9,942,534 (GRCm39) V102A probably benign Het
Sh2b1 T C 7: 126,068,354 (GRCm39) T486A probably damaging Het
Slc22a5 C T 11: 53,766,981 (GRCm39) R169H probably damaging Het
Slc4a5 T C 6: 83,266,223 (GRCm39) V889A possibly damaging Het
Spast C A 17: 74,646,069 (GRCm39) S13* probably null Het
Srek1 T C 13: 103,889,654 (GRCm39) probably null Het
Sugp1 G T 8: 70,509,220 (GRCm39) E164D probably benign Het
Synpo2 T C 3: 122,910,973 (GRCm39) D224G probably benign Het
Tanc1 A G 2: 59,630,432 (GRCm39) D804G probably damaging Het
Tep1 C T 14: 51,081,766 (GRCm39) C1228Y probably damaging Het
Tes T A 6: 17,100,341 (GRCm39) C325S probably benign Het
Themis T C 10: 28,739,390 (GRCm39) V620A probably benign Het
Trim17 T C 11: 58,862,257 (GRCm39) S430P probably damaging Het
Tubgcp5 T C 7: 55,445,693 (GRCm39) I65T possibly damaging Het
Unc13b T C 4: 43,171,955 (GRCm39) S928P unknown Het
Vat1l C T 8: 115,016,172 (GRCm39) A354V probably damaging Het
Vmn1r170 T A 7: 23,306,263 (GRCm39) S222T probably benign Het
Vmn2r112 A T 17: 22,820,213 (GRCm39) M29L probably benign Het
Vmn2r72 T C 7: 85,400,411 (GRCm39) I213V probably benign Het
Wdr89 T A 12: 75,679,564 (GRCm39) Q230L possibly damaging Het
Zfp386 A G 12: 116,023,283 (GRCm39) T334A probably benign Het
Zfp442 T A 2: 150,251,287 (GRCm39) H205L probably benign Het
Zfyve26 A T 12: 79,323,076 (GRCm39) I890N possibly damaging Het
Zic1 T C 9: 91,246,373 (GRCm39) E233G probably damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32,139,026 (GRCm39) missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32,216,368 (GRCm39) missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32,493,470 (GRCm39) missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32,134,936 (GRCm39) missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32,287,413 (GRCm39) missense probably benign 0.06
IGL01767:Plxna4 APN 6 32,214,613 (GRCm39) missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32,192,139 (GRCm39) missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32,192,576 (GRCm39) missense probably benign
IGL02299:Plxna4 APN 6 32,142,091 (GRCm39) missense probably benign 0.01
IGL02306:Plxna4 APN 6 32,183,059 (GRCm39) missense probably benign 0.19
IGL02312:Plxna4 APN 6 32,142,052 (GRCm39) missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32,129,840 (GRCm39) missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32,162,346 (GRCm39) missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32,494,541 (GRCm39) missense probably benign 0.03
IGL02701:Plxna4 APN 6 32,494,494 (GRCm39) missense probably benign 0.01
IGL02995:Plxna4 APN 6 32,493,530 (GRCm39) missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32,179,160 (GRCm39) missense probably benign 0.01
IGL03264:Plxna4 APN 6 32,155,337 (GRCm39) missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32,141,986 (GRCm39) splice site probably benign
IGL03382:Plxna4 APN 6 32,179,129 (GRCm39) missense probably benign 0.23
corona UTSW 6 32,494,199 (GRCm39) missense probably damaging 1.00
Disposed UTSW 6 32,493,440 (GRCm39) missense probably damaging 1.00
inclined UTSW 6 32,214,658 (GRCm39) nonsense probably null
Slope UTSW 6 32,211,541 (GRCm39) missense probably benign 0.00
G4846:Plxna4 UTSW 6 32,169,207 (GRCm39) missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32,174,009 (GRCm39) missense probably benign 0.00
R0200:Plxna4 UTSW 6 32,174,023 (GRCm39) missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32,214,703 (GRCm39) missense probably benign 0.01
R0468:Plxna4 UTSW 6 32,192,181 (GRCm39) missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32,179,054 (GRCm39) missense probably benign
R0542:Plxna4 UTSW 6 32,169,232 (GRCm39) missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32,134,950 (GRCm39) missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32,162,436 (GRCm39) missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32,174,091 (GRCm39) missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32,228,071 (GRCm39) missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32,201,087 (GRCm39) splice site probably null
R1569:Plxna4 UTSW 6 32,162,410 (GRCm39) missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32,494,379 (GRCm39) missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32,174,761 (GRCm39) missense probably benign 0.01
R2068:Plxna4 UTSW 6 32,494,551 (GRCm39) missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32,493,909 (GRCm39) missense probably benign 0.00
R2842:Plxna4 UTSW 6 32,192,566 (GRCm39) critical splice donor site probably null
R2849:Plxna4 UTSW 6 32,162,467 (GRCm39) missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32,493,972 (GRCm39) missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32,142,715 (GRCm39) missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32,192,589 (GRCm39) missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32,213,300 (GRCm39) nonsense probably null
R4276:Plxna4 UTSW 6 32,177,883 (GRCm39) missense probably benign 0.29
R4307:Plxna4 UTSW 6 32,140,444 (GRCm39) missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32,127,480 (GRCm39) nonsense probably null
R4478:Plxna4 UTSW 6 32,173,068 (GRCm39) missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32,473,831 (GRCm39) critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32,494,338 (GRCm39) missense probably benign 0.00
R4568:Plxna4 UTSW 6 32,129,873 (GRCm39) missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32,493,885 (GRCm39) missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32,142,779 (GRCm39) missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32,493,623 (GRCm39) missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32,142,697 (GRCm39) missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32,201,094 (GRCm39) splice site probably null
R5181:Plxna4 UTSW 6 32,493,932 (GRCm39) missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32,228,007 (GRCm39) missense probably benign 0.03
R5259:Plxna4 UTSW 6 32,493,956 (GRCm39) missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32,183,056 (GRCm39) missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32,494,218 (GRCm39) missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32,155,293 (GRCm39) missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32,183,165 (GRCm39) missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32,134,915 (GRCm39) missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32,214,658 (GRCm39) nonsense probably null
R5653:Plxna4 UTSW 6 32,494,551 (GRCm39) missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32,192,657 (GRCm39) missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32,214,711 (GRCm39) missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32,494,181 (GRCm39) missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32,211,541 (GRCm39) missense probably benign 0.00
R5973:Plxna4 UTSW 6 32,228,000 (GRCm39) splice site probably null
R6433:Plxna4 UTSW 6 32,192,613 (GRCm39) missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32,493,672 (GRCm39) missense probably benign
R6560:Plxna4 UTSW 6 32,192,613 (GRCm39) missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32,177,794 (GRCm39) missense probably benign 0.26
R6810:Plxna4 UTSW 6 32,287,457 (GRCm39) missense probably benign 0.18
R6985:Plxna4 UTSW 6 32,214,643 (GRCm39) missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32,169,204 (GRCm39) missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32,493,440 (GRCm39) missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32,494,199 (GRCm39) missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32,473,691 (GRCm39) missense probably benign 0.01
R7199:Plxna4 UTSW 6 32,192,113 (GRCm39) nonsense probably null
R7248:Plxna4 UTSW 6 32,139,095 (GRCm39) missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32,216,455 (GRCm39) missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32,173,057 (GRCm39) critical splice donor site probably null
R7383:Plxna4 UTSW 6 32,129,734 (GRCm39) critical splice donor site probably null
R7405:Plxna4 UTSW 6 32,173,254 (GRCm39) missense probably benign 0.00
R7516:Plxna4 UTSW 6 32,214,703 (GRCm39) missense probably benign 0.00
R7635:Plxna4 UTSW 6 32,473,676 (GRCm39) missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32,129,807 (GRCm39) missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32,200,915 (GRCm39) missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32,183,168 (GRCm39) critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32,493,981 (GRCm39) missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32,493,885 (GRCm39) missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32,139,038 (GRCm39) missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32,129,789 (GRCm39) missense probably benign 0.25
R8305:Plxna4 UTSW 6 32,188,000 (GRCm39) missense possibly damaging 0.81
R8438:Plxna4 UTSW 6 32,179,115 (GRCm39) missense probably damaging 1.00
R8493:Plxna4 UTSW 6 32,192,647 (GRCm39) missense probably benign 0.27
R8714:Plxna4 UTSW 6 32,140,379 (GRCm39) nonsense probably null
R8759:Plxna4 UTSW 6 32,169,276 (GRCm39) missense probably damaging 1.00
R8822:Plxna4 UTSW 6 32,127,431 (GRCm39) missense possibly damaging 0.89
R8844:Plxna4 UTSW 6 32,174,026 (GRCm39) missense probably benign 0.11
R8974:Plxna4 UTSW 6 32,216,447 (GRCm39) missense possibly damaging 0.79
R9020:Plxna4 UTSW 6 32,211,497 (GRCm39) missense possibly damaging 0.90
R9144:Plxna4 UTSW 6 32,162,496 (GRCm39) missense possibly damaging 0.77
R9206:Plxna4 UTSW 6 32,494,379 (GRCm39) missense probably damaging 0.98
R9208:Plxna4 UTSW 6 32,494,379 (GRCm39) missense probably damaging 0.98
R9257:Plxna4 UTSW 6 32,139,018 (GRCm39) missense probably damaging 0.99
R9411:Plxna4 UTSW 6 32,159,682 (GRCm39) missense probably damaging 1.00
R9469:Plxna4 UTSW 6 32,494,526 (GRCm39) missense probably benign
R9583:Plxna4 UTSW 6 32,192,169 (GRCm39) missense possibly damaging 0.78
R9647:Plxna4 UTSW 6 32,228,044 (GRCm39) missense probably damaging 1.00
R9695:Plxna4 UTSW 6 32,183,056 (GRCm39) missense probably benign 0.02
R9801:Plxna4 UTSW 6 32,140,526 (GRCm39) critical splice acceptor site probably null
V1024:Plxna4 UTSW 6 32,211,509 (GRCm39) missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32,493,979 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGGCTCACGGAACCTG -3'
(R):5'- TCTGGGAGCCCTTCCTATTG -3'

Sequencing Primer
(F):5'- CCAATTCCAAGGAGACTGTAAAGGC -3'
(R):5'- GGGAGCCCTTCCTATTGTCCTC -3'
Posted On 2022-03-25