Incidental Mutation 'R9269:Tubgcp5'
ID 702754
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Name tubulin, gamma complex component 5
Synonyms GCP5, B130010C12Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 55443873-55481207 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55445693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 65 (I65T)
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191] [ENSMUST00000206454]
AlphaFold Q8BKN5
Predicted Effect possibly damaging
Transcript: ENSMUST00000032627
AA Change: I65T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: I65T

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205796
AA Change: I65T

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000206191
AA Change: I65T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206454
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,637,865 (GRCm39) S845P probably benign Het
Actn1 T A 12: 80,219,745 (GRCm39) N709Y probably benign Het
Alox5ap A G 5: 149,216,006 (GRCm39) Y64C probably damaging Het
Anapc4 T A 5: 53,018,620 (GRCm39) S521T possibly damaging Het
Ap3b1 C A 13: 94,540,570 (GRCm39) P164Q probably damaging Het
Arhgef26 A G 3: 62,247,920 (GRCm39) N335D probably damaging Het
Arrdc2 G A 8: 71,288,973 (GRCm39) A354V probably benign Het
Atg2b A G 12: 105,618,359 (GRCm39) S898P probably damaging Het
Atxn1 T A 13: 45,710,680 (GRCm39) T751S probably benign Het
Begain T A 12: 108,999,119 (GRCm39) R551W possibly damaging Het
Borcs8 C A 8: 70,594,521 (GRCm39) D15E probably benign Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Card11 A T 5: 140,892,516 (GRCm39) M183K probably damaging Het
Cldn3 T C 5: 135,015,579 (GRCm39) L94P probably damaging Het
Clvs2 A T 10: 33,419,422 (GRCm39) Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cop1 C T 1: 159,116,553 (GRCm39) P409L probably benign Het
Cplane1 A C 15: 8,248,500 (GRCm39) Q1683P probably damaging Het
Crhbp C A 13: 95,573,024 (GRCm39) A241S probably benign Het
Cyfip1 C A 7: 55,557,179 (GRCm39) S794* probably null Het
Dlg5 T A 14: 24,242,881 (GRCm39) H172L probably damaging Het
Doc2a T A 7: 126,450,159 (GRCm39) I199N probably benign Het
Dock3 T C 9: 106,818,522 (GRCm39) T1191A probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Eif4a3l2 C T 6: 116,529,317 (GRCm39) T398I probably damaging Het
Fcgr1 C T 3: 96,193,154 (GRCm39) R281H probably benign Het
Fndc10 T C 4: 155,779,205 (GRCm39) V83A possibly damaging Het
Galnt2 T A 8: 125,065,202 (GRCm39) I444K probably benign Het
Gcnt3 T C 9: 69,941,290 (GRCm39) Y426C probably damaging Het
Gtpbp1 C T 15: 79,601,855 (GRCm39) R533C probably damaging Het
Hid1 T C 11: 115,252,502 (GRCm39) E60G probably damaging Het
Ighv1-81 A T 12: 115,884,161 (GRCm39) L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,618,565 (GRCm39) probably null Het
Ilrun A C 17: 28,005,049 (GRCm39) Y169* probably null Het
Klf10 A G 15: 38,298,002 (GRCm39) L44P probably damaging Het
Lamc3 T C 2: 31,813,017 (GRCm39) V1001A probably benign Het
Lamc3 C A 2: 31,818,908 (GRCm39) S1211* probably null Het
Lmx1a T A 1: 167,658,194 (GRCm39) H192Q probably benign Het
Nkx2-4 T C 2: 146,926,184 (GRCm39) H226R possibly damaging Het
Or2d2 T C 7: 106,727,833 (GRCm39) I256V probably benign Het
Or4a68 T A 2: 89,270,276 (GRCm39) M116L probably damaging Het
Or4k37 T C 2: 111,159,297 (GRCm39) F178L probably damaging Het
Or4p18 G A 2: 88,232,586 (GRCm39) R231C probably benign Het
Or5b101 T C 19: 13,004,994 (GRCm39) H233R probably benign Het
Or5b114-ps1 A T 19: 13,353,004 (GRCm39) N226I unknown Het
Or5p52 T A 7: 107,502,527 (GRCm39) I201N possibly damaging Het
Or7e175 T C 9: 20,048,757 (GRCm39) M115T probably damaging Het
Or8k1 T C 2: 86,047,247 (GRCm39) H269R probably damaging Het
Orai3 G T 7: 127,373,194 (GRCm39) A232S probably benign Het
Pak1ip1 G A 13: 41,162,727 (GRCm39) G177R probably benign Het
Pcp4l1 T C 1: 171,001,975 (GRCm39) R62G possibly damaging Het
Phox2b T A 5: 67,256,064 (GRCm39) Q74L probably benign Het
Pi4kb A G 3: 94,891,797 (GRCm39) Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxna1 T C 6: 89,306,541 (GRCm39) R1430G probably null Het
Plxna4 T C 6: 32,155,315 (GRCm39) H1543R probably benign Het
Prcc A T 3: 87,777,038 (GRCm39) F312Y probably damaging Het
Ranbp6 A G 19: 29,787,388 (GRCm39) L988P probably damaging Het
Rbm27 A G 18: 42,460,572 (GRCm39) T840A probably benign Het
Rchy1 G T 5: 92,105,831 (GRCm39) T39N probably benign Het
Rmi1 C T 13: 58,556,840 (GRCm39) T363I probably benign Het
Rnpc3 A C 3: 113,404,895 (GRCm39) I420S probably damaging Het
Rsph4a T A 10: 33,785,394 (GRCm39) V435E probably benign Het
Rwdd1 T C 10: 33,888,095 (GRCm39) T38A probably damaging Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Sel1l3 T C 5: 53,311,628 (GRCm39) Y619C probably damaging Het
Sf3b3 T C 8: 111,538,658 (GRCm39) T1121A probably damaging Het
Sgk3 T C 1: 9,942,534 (GRCm39) V102A probably benign Het
Sh2b1 T C 7: 126,068,354 (GRCm39) T486A probably damaging Het
Slc22a5 C T 11: 53,766,981 (GRCm39) R169H probably damaging Het
Slc4a5 T C 6: 83,266,223 (GRCm39) V889A possibly damaging Het
Spast C A 17: 74,646,069 (GRCm39) S13* probably null Het
Srek1 T C 13: 103,889,654 (GRCm39) probably null Het
Sugp1 G T 8: 70,509,220 (GRCm39) E164D probably benign Het
Synpo2 T C 3: 122,910,973 (GRCm39) D224G probably benign Het
Tanc1 A G 2: 59,630,432 (GRCm39) D804G probably damaging Het
Tep1 C T 14: 51,081,766 (GRCm39) C1228Y probably damaging Het
Tes T A 6: 17,100,341 (GRCm39) C325S probably benign Het
Themis T C 10: 28,739,390 (GRCm39) V620A probably benign Het
Trim17 T C 11: 58,862,257 (GRCm39) S430P probably damaging Het
Unc13b T C 4: 43,171,955 (GRCm39) S928P unknown Het
Vat1l C T 8: 115,016,172 (GRCm39) A354V probably damaging Het
Vmn1r170 T A 7: 23,306,263 (GRCm39) S222T probably benign Het
Vmn2r112 A T 17: 22,820,213 (GRCm39) M29L probably benign Het
Vmn2r72 T C 7: 85,400,411 (GRCm39) I213V probably benign Het
Wdr89 T A 12: 75,679,564 (GRCm39) Q230L possibly damaging Het
Zfp386 A G 12: 116,023,283 (GRCm39) T334A probably benign Het
Zfp442 T A 2: 150,251,287 (GRCm39) H205L probably benign Het
Zfyve26 A T 12: 79,323,076 (GRCm39) I890N possibly damaging Het
Zic1 T C 9: 91,246,373 (GRCm39) E233G probably damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55,456,343 (GRCm39) missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55,458,277 (GRCm39) missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55,445,779 (GRCm39) splice site probably benign
IGL01597:Tubgcp5 APN 7 55,456,580 (GRCm39) splice site probably benign
IGL01688:Tubgcp5 APN 7 55,464,766 (GRCm39) missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55,449,221 (GRCm39) missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55,455,836 (GRCm39) missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55,468,505 (GRCm39) missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55,456,355 (GRCm39) nonsense probably null
IGL03105:Tubgcp5 APN 7 55,475,329 (GRCm39) missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55,458,277 (GRCm39) missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55,464,726 (GRCm39) missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55,450,432 (GRCm39) missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R0488:Tubgcp5 UTSW 7 55,479,086 (GRCm39) missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55,464,599 (GRCm39) splice site probably benign
R0885:Tubgcp5 UTSW 7 55,455,803 (GRCm39) nonsense probably null
R1483:Tubgcp5 UTSW 7 55,475,455 (GRCm39) critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55,458,285 (GRCm39) missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55,464,768 (GRCm39) missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55,449,259 (GRCm39) missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55,480,629 (GRCm39) missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55,480,614 (GRCm39) missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55,443,933 (GRCm39) unclassified probably benign
R4948:Tubgcp5 UTSW 7 55,455,871 (GRCm39) missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55,458,385 (GRCm39) missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55,473,433 (GRCm39) missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55,464,710 (GRCm39) missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55,473,357 (GRCm39) missense probably benign
R6141:Tubgcp5 UTSW 7 55,456,526 (GRCm39) missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55,445,671 (GRCm39) missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55,467,140 (GRCm39) nonsense probably null
R6563:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55,473,331 (GRCm39) missense probably benign
R6596:Tubgcp5 UTSW 7 55,456,382 (GRCm39) missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55,443,977 (GRCm39) missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55,455,114 (GRCm39) missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55,479,155 (GRCm39) missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55,450,443 (GRCm39) nonsense probably null
R7213:Tubgcp5 UTSW 7 55,455,860 (GRCm39) missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R7600:Tubgcp5 UTSW 7 55,458,261 (GRCm39) missense probably benign
R7813:Tubgcp5 UTSW 7 55,450,444 (GRCm39) missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55,466,310 (GRCm39) missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55,443,996 (GRCm39) missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R9087:Tubgcp5 UTSW 7 55,467,106 (GRCm39) missense probably damaging 1.00
R9211:Tubgcp5 UTSW 7 55,456,331 (GRCm39) missense probably benign 0.05
R9329:Tubgcp5 UTSW 7 55,479,181 (GRCm39) critical splice donor site probably null
R9355:Tubgcp5 UTSW 7 55,467,177 (GRCm39) critical splice donor site probably null
R9498:Tubgcp5 UTSW 7 55,463,233 (GRCm39) missense possibly damaging 0.46
R9687:Tubgcp5 UTSW 7 55,475,327 (GRCm39) critical splice acceptor site probably null
Z1088:Tubgcp5 UTSW 7 55,464,849 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCAGGGGTGTCAGACATATG -3'
(R):5'- ACTACAACTGGAGAGCTCACGG -3'

Sequencing Primer
(F):5'- TGTCAGACATATGCAGGGAC -3'
(R):5'- CTAAATAGCTTTTGAGAACGC -3'
Posted On 2022-03-25