Incidental Mutation 'R9269:Vmn2r72'
ID 702756
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Name vomeronasal 2, receptor 72
Synonyms Vmn2r72-ps, EG244114
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 85737784-85754981 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85751203 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 213 (I213V)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
AlphaFold D3Z4N8
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: I213V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I213V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A C 15: 8,219,016 Q1683P probably damaging Het
A2m T C 6: 121,660,906 S845P probably benign Het
Actn1 T A 12: 80,172,971 N709Y probably benign Het
Alox5ap A G 5: 149,279,196 Y64C probably damaging Het
Anapc4 T A 5: 52,861,278 S521T possibly damaging Het
Ap3b1 C A 13: 94,404,062 P164Q probably damaging Het
Arhgef26 A G 3: 62,340,499 N335D probably damaging Het
Arrdc2 G A 8: 70,836,329 A354V probably benign Het
Atg2b A G 12: 105,652,100 S898P probably damaging Het
Atxn1 T A 13: 45,557,204 T751S probably benign Het
Begain T A 12: 109,033,193 R551W possibly damaging Het
Borcs8 C A 8: 70,141,871 D15E probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Card11 A T 5: 140,906,761 M183K probably damaging Het
Cldn3 T C 5: 134,986,725 L94P probably damaging Het
Clvs2 A T 10: 33,543,426 Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cop1 C T 1: 159,288,983 P409L probably benign Het
Crhbp C A 13: 95,436,516 A241S probably benign Het
Cyfip1 C A 7: 55,907,431 S794* probably null Het
D17Wsu92e A C 17: 27,786,075 Y169* probably null Het
Dlg5 T A 14: 24,192,813 H172L probably damaging Het
Doc2a T A 7: 126,850,987 I199N probably benign Het
Dock3 T C 9: 106,941,323 T1191A probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Fcgr1 C T 3: 96,285,838 R281H probably benign Het
Fndc10 T C 4: 155,694,748 V83A possibly damaging Het
Galnt2 T A 8: 124,338,463 I444K probably benign Het
Gcnt3 T C 9: 70,034,008 Y426C probably damaging Het
Gm5580 C T 6: 116,552,356 T398I probably damaging Het
Gtpbp1 C T 15: 79,717,654 R533C probably damaging Het
Hid1 T C 11: 115,361,676 E60G probably damaging Het
Ighv1-81 A T 12: 115,920,541 L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Klf10 A G 15: 38,297,758 L44P probably damaging Het
Lamc3 T C 2: 31,923,005 V1001A probably benign Het
Lamc3 C A 2: 31,928,896 S1211* probably null Het
Lmx1a T A 1: 167,830,625 H192Q probably benign Het
Nkx2-4 T C 2: 147,084,264 H226R possibly damaging Het
Olfr1046 T C 2: 86,216,903 H269R probably damaging Het
Olfr1179 G A 2: 88,402,242 R231C probably benign Het
Olfr1240 T A 2: 89,439,932 M116L probably damaging Het
Olfr1281 T C 2: 111,328,952 F178L probably damaging Het
Olfr1453 T C 19: 13,027,630 H233R probably benign Het
Olfr1468-ps1 A T 19: 13,375,640 N226I unknown Het
Olfr472 T A 7: 107,903,320 I201N possibly damaging Het
Olfr715 T C 7: 107,128,626 I256V probably benign Het
Olfr869 T C 9: 20,137,461 M115T probably damaging Het
Orai3 G T 7: 127,774,022 A232S probably benign Het
Pak1ip1 G A 13: 41,009,251 G177R probably benign Het
Pcp4l1 T C 1: 171,174,406 R62G possibly damaging Het
Phox2b T A 5: 67,098,721 Q74L probably benign Het
Pi4kb A G 3: 94,984,486 Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 T C 6: 89,329,559 R1430G probably null Het
Plxna4 T C 6: 32,178,380 H1543R probably benign Het
Prcc A T 3: 87,869,731 F312Y probably damaging Het
Ranbp6 A G 19: 29,809,988 L988P probably damaging Het
Rbm27 A G 18: 42,327,507 T840A probably benign Het
Rchy1 G T 5: 91,957,972 T39N probably benign Het
Rmi1 C T 13: 58,409,026 T363I probably benign Het
Rnpc3 A C 3: 113,611,246 I420S probably damaging Het
Rsph4a T A 10: 33,909,398 V435E probably benign Het
Rwdd1 T C 10: 34,012,099 T38A probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Sel1l3 T C 5: 53,154,286 Y619C probably damaging Het
Sf3b3 T C 8: 110,812,026 T1121A probably damaging Het
Sgk3 T C 1: 9,872,309 V102A probably benign Het
Sh2b1 T C 7: 126,469,182 T486A probably damaging Het
Slc22a5 C T 11: 53,876,155 R169H probably damaging Het
Slc4a5 T C 6: 83,289,241 V889A possibly damaging Het
Spast C A 17: 74,339,074 S13* probably null Het
Srek1 T C 13: 103,753,146 probably null Het
Sugp1 G T 8: 70,056,570 E164D probably benign Het
Synpo2 T C 3: 123,117,324 D224G probably benign Het
Tanc1 A G 2: 59,800,088 D804G probably damaging Het
Tep1 C T 14: 50,844,309 C1228Y probably damaging Het
Tes T A 6: 17,100,342 C325S probably benign Het
Themis T C 10: 28,863,394 V620A probably benign Het
Trim17 T C 11: 58,971,431 S430P probably damaging Het
Tubgcp5 T C 7: 55,795,945 I65T possibly damaging Het
Unc13b T C 4: 43,171,955 S928P unknown Het
Vat1l C T 8: 114,289,432 A354V probably damaging Het
Vmn1r170 T A 7: 23,606,838 S222T probably benign Het
Vmn2r112 A T 17: 22,601,232 M29L probably benign Het
Wdr89 T A 12: 75,632,790 Q230L possibly damaging Het
Zfp386 A G 12: 116,059,663 T334A probably benign Het
Zfp442 T A 2: 150,409,367 H205L probably benign Het
Zfyve26 A T 12: 79,276,302 I890N possibly damaging Het
Zic1 T C 9: 91,364,320 E233G probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
R8989:Vmn2r72 UTSW 7 85754926 missense probably benign 0.10
R9015:Vmn2r72 UTSW 7 85749180 missense probably benign 0.01
R9080:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R9317:Vmn2r72 UTSW 7 85754814 missense probably benign 0.04
R9509:Vmn2r72 UTSW 7 85754867 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTATGGGAGAGGCATAGTCTC -3'
(R):5'- CTAAAGCACACTCTACATCATGTTC -3'

Sequencing Primer
(F):5'- GAGAGGCATAGTCTCCATAAACTATC -3'
(R):5'- CTCTACATCATGTTCATATTTTTGCC -3'
Posted On 2022-03-25