Incidental Mutation 'R9269:Atxn1'
ID 702790
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Name ataxin 1
Synonyms 2900016G23Rik, Atx1, Sca1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 45549755-45965008 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45557204 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 751 (T751S)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
AlphaFold P54254
Predicted Effect probably benign
Transcript: ENSMUST00000091628
AA Change: T743S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: T743S

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167708
AA Change: T743S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: T743S

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180110
AA Change: T751S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: T751S

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A C 15: 8,219,016 Q1683P probably damaging Het
A2m T C 6: 121,660,906 S845P probably benign Het
Actn1 T A 12: 80,172,971 N709Y probably benign Het
Alox5ap A G 5: 149,279,196 Y64C probably damaging Het
Anapc4 T A 5: 52,861,278 S521T possibly damaging Het
Ap3b1 C A 13: 94,404,062 P164Q probably damaging Het
Arhgef26 A G 3: 62,340,499 N335D probably damaging Het
Arrdc2 G A 8: 70,836,329 A354V probably benign Het
Atg2b A G 12: 105,652,100 S898P probably damaging Het
Begain T A 12: 109,033,193 R551W possibly damaging Het
Borcs8 C A 8: 70,141,871 D15E probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Card11 A T 5: 140,906,761 M183K probably damaging Het
Cldn3 T C 5: 134,986,725 L94P probably damaging Het
Clvs2 A T 10: 33,543,426 Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cop1 C T 1: 159,288,983 P409L probably benign Het
Crhbp C A 13: 95,436,516 A241S probably benign Het
Cyfip1 C A 7: 55,907,431 S794* probably null Het
D17Wsu92e A C 17: 27,786,075 Y169* probably null Het
Dlg5 T A 14: 24,192,813 H172L probably damaging Het
Doc2a T A 7: 126,850,987 I199N probably benign Het
Dock3 T C 9: 106,941,323 T1191A probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Fcgr1 C T 3: 96,285,838 R281H probably benign Het
Fndc10 T C 4: 155,694,748 V83A possibly damaging Het
Galnt2 T A 8: 124,338,463 I444K probably benign Het
Gcnt3 T C 9: 70,034,008 Y426C probably damaging Het
Gm5580 C T 6: 116,552,356 T398I probably damaging Het
Gtpbp1 C T 15: 79,717,654 R533C probably damaging Het
Hid1 T C 11: 115,361,676 E60G probably damaging Het
Ighv1-81 A T 12: 115,920,541 L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Klf10 A G 15: 38,297,758 L44P probably damaging Het
Lamc3 T C 2: 31,923,005 V1001A probably benign Het
Lamc3 C A 2: 31,928,896 S1211* probably null Het
Lmx1a T A 1: 167,830,625 H192Q probably benign Het
Nkx2-4 T C 2: 147,084,264 H226R possibly damaging Het
Olfr1046 T C 2: 86,216,903 H269R probably damaging Het
Olfr1179 G A 2: 88,402,242 R231C probably benign Het
Olfr1240 T A 2: 89,439,932 M116L probably damaging Het
Olfr1281 T C 2: 111,328,952 F178L probably damaging Het
Olfr1453 T C 19: 13,027,630 H233R probably benign Het
Olfr1468-ps1 A T 19: 13,375,640 N226I unknown Het
Olfr472 T A 7: 107,903,320 I201N possibly damaging Het
Olfr715 T C 7: 107,128,626 I256V probably benign Het
Olfr869 T C 9: 20,137,461 M115T probably damaging Het
Orai3 G T 7: 127,774,022 A232S probably benign Het
Pak1ip1 G A 13: 41,009,251 G177R probably benign Het
Pcp4l1 T C 1: 171,174,406 R62G possibly damaging Het
Phox2b T A 5: 67,098,721 Q74L probably benign Het
Pi4kb A G 3: 94,984,486 Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 T C 6: 89,329,559 R1430G probably null Het
Plxna4 T C 6: 32,178,380 H1543R probably benign Het
Prcc A T 3: 87,869,731 F312Y probably damaging Het
Ranbp6 A G 19: 29,809,988 L988P probably damaging Het
Rbm27 A G 18: 42,327,507 T840A probably benign Het
Rchy1 G T 5: 91,957,972 T39N probably benign Het
Rmi1 C T 13: 58,409,026 T363I probably benign Het
Rnpc3 A C 3: 113,611,246 I420S probably damaging Het
Rsph4a T A 10: 33,909,398 V435E probably benign Het
Rwdd1 T C 10: 34,012,099 T38A probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Sel1l3 T C 5: 53,154,286 Y619C probably damaging Het
Sf3b3 T C 8: 110,812,026 T1121A probably damaging Het
Sgk3 T C 1: 9,872,309 V102A probably benign Het
Sh2b1 T C 7: 126,469,182 T486A probably damaging Het
Slc22a5 C T 11: 53,876,155 R169H probably damaging Het
Slc4a5 T C 6: 83,289,241 V889A possibly damaging Het
Spast C A 17: 74,339,074 S13* probably null Het
Srek1 T C 13: 103,753,146 probably null Het
Sugp1 G T 8: 70,056,570 E164D probably benign Het
Synpo2 T C 3: 123,117,324 D224G probably benign Het
Tanc1 A G 2: 59,800,088 D804G probably damaging Het
Tep1 C T 14: 50,844,309 C1228Y probably damaging Het
Tes T A 6: 17,100,342 C325S probably benign Het
Themis T C 10: 28,863,394 V620A probably benign Het
Trim17 T C 11: 58,971,431 S430P probably damaging Het
Tubgcp5 T C 7: 55,795,945 I65T possibly damaging Het
Unc13b T C 4: 43,171,955 S928P unknown Het
Vat1l C T 8: 114,289,432 A354V probably damaging Het
Vmn1r170 T A 7: 23,606,838 S222T probably benign Het
Vmn2r112 A T 17: 22,601,232 M29L probably benign Het
Vmn2r72 T C 7: 85,751,203 I213V probably benign Het
Wdr89 T A 12: 75,632,790 Q230L possibly damaging Het
Zfp386 A G 12: 116,059,663 T334A probably benign Het
Zfp442 T A 2: 150,409,367 H205L probably benign Het
Zfyve26 A T 12: 79,276,302 I890N possibly damaging Het
Zic1 T C 9: 91,364,320 E233G probably damaging Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45568427 utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45567193 missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45557314 missense probably benign 0.00
IGL01512:Atxn1 APN 13 45566601 missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45566722 missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45568225 missense probably benign 0.00
IGL02333:Atxn1 APN 13 45567204 missense probably damaging 1.00
Cormorant UTSW 13 45557069 missense probably damaging 1.00
pelagic UTSW 13 45566812 missense probably benign 0.05
R0136:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0180:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R0299:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45557530 missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45557423 missense probably benign 0.08
R1484:Atxn1 UTSW 13 45557576 nonsense probably null
R1532:Atxn1 UTSW 13 45566910 missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45567804 missense probably benign 0.27
R2277:Atxn1 UTSW 13 45557068 missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R2849:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R4326:Atxn1 UTSW 13 45965967 unclassified probably benign
R4626:Atxn1 UTSW 13 45567099 missense probably damaging 1.00
R4768:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R4944:Atxn1 UTSW 13 45566931 missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45557069 missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45557093 missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45568368 missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45557254 missense probably benign 0.14
R5561:Atxn1 UTSW 13 45566871 missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45557377 missense probably benign 0.17
R6092:Atxn1 UTSW 13 45566812 missense probably benign 0.05
R6272:Atxn1 UTSW 13 45567762 missense possibly damaging 0.49
R6372:Atxn1 UTSW 13 45557456 missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45567671 missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45567619 missense probably benign 0.04
R7041:Atxn1 UTSW 13 45566835 missense probably damaging 1.00
R7578:Atxn1 UTSW 13 45567358 missense probably benign 0.02
R7600:Atxn1 UTSW 13 45557060 missense possibly damaging 0.90
R8112:Atxn1 UTSW 13 45567957 missense probably benign
R8297:Atxn1 UTSW 13 45567029 missense probably benign
R8411:Atxn1 UTSW 13 45566556 missense probably benign 0.02
R8482:Atxn1 UTSW 13 45567950 missense possibly damaging 0.75
R9022:Atxn1 UTSW 13 45567415 missense probably damaging 1.00
R9310:Atxn1 UTSW 13 45568018 missense probably damaging 1.00
R9514:Atxn1 UTSW 13 45567957 missense probably benign
R9626:Atxn1 UTSW 13 45557320 missense possibly damaging 0.92
R9673:Atxn1 UTSW 13 45557146 missense probably benign 0.01
R9744:Atxn1 UTSW 13 45567823 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCGACACACCTGTTTGAC -3'
(R):5'- CAAGAACCTGAAGAATGGCTCTG -3'

Sequencing Primer
(F):5'- GACACACCTGTTTGACTCTAATGAC -3'
(R):5'- CTCTGTTAAAAAGGGCCAGCCTG -3'
Posted On 2022-03-25