Incidental Mutation 'R0750:Igf1r'
ID70280
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 038930-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0750 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68212091 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1133 (F1133S)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: F1133S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: F1133S

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208871
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A T 4: 156,166,937 L1974* probably null Het
Brd4 T C 17: 32,220,252 E418G probably benign Het
Brip1 G A 11: 86,061,499 S1152L possibly damaging Het
Btrc T G 19: 45,503,146 F81C probably damaging Het
C87499 A G 4: 88,627,668 F479S probably benign Het
Cep85l A G 10: 53,281,546 L585P probably damaging Het
Cfap46 T G 7: 139,654,670 E671D probably damaging Het
Dsg1a T C 18: 20,340,153 L761P probably benign Het
Ece2 G T 16: 20,633,050 V396L probably benign Het
Fam71a G A 1: 191,164,485 probably benign Het
Hs6st3 CGGAGGAGGAGGAGGAGGA CGGAGGAGGAGGAGGA 14: 119,138,707 probably benign Het
Id2 A G 12: 25,095,671 S114P probably damaging Het
Izumo1 T C 7: 45,626,283 probably null Het
Krt35 A G 11: 100,096,153 S12P possibly damaging Het
Olfr76 T C 19: 12,120,713 probably null Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Tmed6 T C 8: 107,061,769 Y182C possibly damaging Het
Tmem174 G T 13: 98,637,279 N14K probably damaging Het
Tmem87b T C 2: 128,818,436 L33P possibly damaging Het
Vmn1r16 T C 6: 57,322,827 Y270C probably benign Het
Vps37d A T 5: 135,074,440 L116Q possibly damaging Het
Zfp592 A G 7: 81,024,745 S486G probably benign Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGTAGCTCCCAACATAAGCTTCAGG -3'
(R):5'- GCAGACTAATGACTGCAAAGTCCCC -3'

Sequencing Primer
(F):5'- cccccacatccatgcac -3'
(R):5'- AGTCCCCTCAGCACCTG -3'
Posted On2013-09-30