Incidental Mutation 'R9269:D17Wsu92e'
ID 702801
Institutional Source Beutler Lab
Gene Symbol D17Wsu92e
Ensembl Gene ENSMUSG00000056692
Gene Name DNA segment, Chr 17, Wayne State University 92, expressed
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 27751232-27820558 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 27786075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 169 (Y169*)
Ref Sequence ENSEMBL: ENSMUSP00000074585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075076] [ENSMUST00000114859] [ENSMUST00000114863]
AlphaFold Q3TT38
Predicted Effect probably null
Transcript: ENSMUST00000075076
AA Change: Y169*
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692
AA Change: Y169*

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114859
AA Change: Y169*
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692
AA Change: Y169*

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114863
AA Change: Y169*
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692
AA Change: Y169*

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A C 15: 8,219,016 Q1683P probably damaging Het
A2m T C 6: 121,660,906 S845P probably benign Het
Actn1 T A 12: 80,172,971 N709Y probably benign Het
Alox5ap A G 5: 149,279,196 Y64C probably damaging Het
Anapc4 T A 5: 52,861,278 S521T possibly damaging Het
Ap3b1 C A 13: 94,404,062 P164Q probably damaging Het
Arhgef26 A G 3: 62,340,499 N335D probably damaging Het
Arrdc2 G A 8: 70,836,329 A354V probably benign Het
Atg2b A G 12: 105,652,100 S898P probably damaging Het
Atxn1 T A 13: 45,557,204 T751S probably benign Het
Begain T A 12: 109,033,193 R551W possibly damaging Het
Borcs8 C A 8: 70,141,871 D15E probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Card11 A T 5: 140,906,761 M183K probably damaging Het
Cldn3 T C 5: 134,986,725 L94P probably damaging Het
Clvs2 A T 10: 33,543,426 Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cop1 C T 1: 159,288,983 P409L probably benign Het
Crhbp C A 13: 95,436,516 A241S probably benign Het
Cyfip1 C A 7: 55,907,431 S794* probably null Het
Dlg5 T A 14: 24,192,813 H172L probably damaging Het
Doc2a T A 7: 126,850,987 I199N probably benign Het
Dock3 T C 9: 106,941,323 T1191A probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Fcgr1 C T 3: 96,285,838 R281H probably benign Het
Fndc10 T C 4: 155,694,748 V83A possibly damaging Het
Galnt2 T A 8: 124,338,463 I444K probably benign Het
Gcnt3 T C 9: 70,034,008 Y426C probably damaging Het
Gm5580 C T 6: 116,552,356 T398I probably damaging Het
Gtpbp1 C T 15: 79,717,654 R533C probably damaging Het
Hid1 T C 11: 115,361,676 E60G probably damaging Het
Ighv1-81 A T 12: 115,920,541 L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Klf10 A G 15: 38,297,758 L44P probably damaging Het
Lamc3 T C 2: 31,923,005 V1001A probably benign Het
Lamc3 C A 2: 31,928,896 S1211* probably null Het
Lmx1a T A 1: 167,830,625 H192Q probably benign Het
Nkx2-4 T C 2: 147,084,264 H226R possibly damaging Het
Olfr1046 T C 2: 86,216,903 H269R probably damaging Het
Olfr1179 G A 2: 88,402,242 R231C probably benign Het
Olfr1240 T A 2: 89,439,932 M116L probably damaging Het
Olfr1281 T C 2: 111,328,952 F178L probably damaging Het
Olfr1453 T C 19: 13,027,630 H233R probably benign Het
Olfr1468-ps1 A T 19: 13,375,640 N226I unknown Het
Olfr472 T A 7: 107,903,320 I201N possibly damaging Het
Olfr715 T C 7: 107,128,626 I256V probably benign Het
Olfr869 T C 9: 20,137,461 M115T probably damaging Het
Orai3 G T 7: 127,774,022 A232S probably benign Het
Pak1ip1 G A 13: 41,009,251 G177R probably benign Het
Pcp4l1 T C 1: 171,174,406 R62G possibly damaging Het
Phox2b T A 5: 67,098,721 Q74L probably benign Het
Pi4kb A G 3: 94,984,486 Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 T C 6: 89,329,559 R1430G probably null Het
Plxna4 T C 6: 32,178,380 H1543R probably benign Het
Prcc A T 3: 87,869,731 F312Y probably damaging Het
Ranbp6 A G 19: 29,809,988 L988P probably damaging Het
Rbm27 A G 18: 42,327,507 T840A probably benign Het
Rchy1 G T 5: 91,957,972 T39N probably benign Het
Rmi1 C T 13: 58,409,026 T363I probably benign Het
Rnpc3 A C 3: 113,611,246 I420S probably damaging Het
Rsph4a T A 10: 33,909,398 V435E probably benign Het
Rwdd1 T C 10: 34,012,099 T38A probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Sel1l3 T C 5: 53,154,286 Y619C probably damaging Het
Sf3b3 T C 8: 110,812,026 T1121A probably damaging Het
Sgk3 T C 1: 9,872,309 V102A probably benign Het
Sh2b1 T C 7: 126,469,182 T486A probably damaging Het
Slc22a5 C T 11: 53,876,155 R169H probably damaging Het
Slc4a5 T C 6: 83,289,241 V889A possibly damaging Het
Spast C A 17: 74,339,074 S13* probably null Het
Srek1 T C 13: 103,753,146 probably null Het
Sugp1 G T 8: 70,056,570 E164D probably benign Het
Synpo2 T C 3: 123,117,324 D224G probably benign Het
Tanc1 A G 2: 59,800,088 D804G probably damaging Het
Tep1 C T 14: 50,844,309 C1228Y probably damaging Het
Tes T A 6: 17,100,342 C325S probably benign Het
Themis T C 10: 28,863,394 V620A probably benign Het
Trim17 T C 11: 58,971,431 S430P probably damaging Het
Tubgcp5 T C 7: 55,795,945 I65T possibly damaging Het
Unc13b T C 4: 43,171,955 S928P unknown Het
Vat1l C T 8: 114,289,432 A354V probably damaging Het
Vmn1r170 T A 7: 23,606,838 S222T probably benign Het
Vmn2r112 A T 17: 22,601,232 M29L probably benign Het
Vmn2r72 T C 7: 85,751,203 I213V probably benign Het
Wdr89 T A 12: 75,632,790 Q230L possibly damaging Het
Zfp386 A G 12: 116,059,663 T334A probably benign Het
Zfp442 T A 2: 150,409,367 H205L probably benign Het
Zfyve26 A T 12: 79,276,302 I890N possibly damaging Het
Zic1 T C 9: 91,364,320 E233G probably damaging Het
Other mutations in D17Wsu92e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:D17Wsu92e APN 17 27767919 missense probably damaging 1.00
IGL01107:D17Wsu92e APN 17 27786069 critical splice donor site probably null
IGL01805:D17Wsu92e APN 17 27767906 splice site probably benign
detroit UTSW 17 27794070 splice site probably null
michigander UTSW 17 27767986 missense probably benign 0.12
R0423:D17Wsu92e UTSW 17 27786233 missense probably damaging 1.00
R0833:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R0836:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R1055:D17Wsu92e UTSW 17 27767936 missense probably damaging 1.00
R1251:D17Wsu92e UTSW 17 27786070 critical splice donor site probably null
R1646:D17Wsu92e UTSW 17 27793960 missense probably damaging 1.00
R4022:D17Wsu92e UTSW 17 27786262 missense probably damaging 0.97
R4604:D17Wsu92e UTSW 17 27820315 missense probably damaging 1.00
R5360:D17Wsu92e UTSW 17 27794046 missense probably damaging 1.00
R6210:D17Wsu92e UTSW 17 27767986 missense probably benign 0.12
R7201:D17Wsu92e UTSW 17 27794070 splice site probably null
R7994:D17Wsu92e UTSW 17 27767943 missense probably benign
R8057:D17Wsu92e UTSW 17 27767889 missense unknown
R8767:D17Wsu92e UTSW 17 27768069 missense probably benign 0.01
R9629:D17Wsu92e UTSW 17 27793939 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCCACTACAGCTTACATTTC -3'
(R):5'- TGTTTGAACTTAGGAGCAGAGGC -3'

Sequencing Primer
(F):5'- TTCTAACATAAAAGGCAGTGCGC -3'
(R):5'- TTAGGAGCAGAGGCCTGGC -3'
Posted On 2022-03-25