Incidental Mutation 'R9269:Or5b101'
ID 702804
Institutional Source Beutler Lab
Gene Symbol Or5b101
Ensembl Gene ENSMUSG00000094755
Gene Name olfactory receptor family 5 subfamily B member 101
Synonyms Olfr1453, GA_x6K02T2RE5P-3357666-3356743, MOR202-6
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 13004768-13005691 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13004994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 233 (H233R)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
AlphaFold Q8VFX0
Predicted Effect probably benign
Transcript: ENSMUST00000087773
AA Change: H233R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: H233R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,637,865 (GRCm39) S845P probably benign Het
Actn1 T A 12: 80,219,745 (GRCm39) N709Y probably benign Het
Alox5ap A G 5: 149,216,006 (GRCm39) Y64C probably damaging Het
Anapc4 T A 5: 53,018,620 (GRCm39) S521T possibly damaging Het
Ap3b1 C A 13: 94,540,570 (GRCm39) P164Q probably damaging Het
Arhgef26 A G 3: 62,247,920 (GRCm39) N335D probably damaging Het
Arrdc2 G A 8: 71,288,973 (GRCm39) A354V probably benign Het
Atg2b A G 12: 105,618,359 (GRCm39) S898P probably damaging Het
Atxn1 T A 13: 45,710,680 (GRCm39) T751S probably benign Het
Begain T A 12: 108,999,119 (GRCm39) R551W possibly damaging Het
Borcs8 C A 8: 70,594,521 (GRCm39) D15E probably benign Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Card11 A T 5: 140,892,516 (GRCm39) M183K probably damaging Het
Cldn3 T C 5: 135,015,579 (GRCm39) L94P probably damaging Het
Clvs2 A T 10: 33,419,422 (GRCm39) Y211N probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cop1 C T 1: 159,116,553 (GRCm39) P409L probably benign Het
Cplane1 A C 15: 8,248,500 (GRCm39) Q1683P probably damaging Het
Crhbp C A 13: 95,573,024 (GRCm39) A241S probably benign Het
Cyfip1 C A 7: 55,557,179 (GRCm39) S794* probably null Het
Dlg5 T A 14: 24,242,881 (GRCm39) H172L probably damaging Het
Doc2a T A 7: 126,450,159 (GRCm39) I199N probably benign Het
Dock3 T C 9: 106,818,522 (GRCm39) T1191A probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Eif4a3l2 C T 6: 116,529,317 (GRCm39) T398I probably damaging Het
Fcgr1 C T 3: 96,193,154 (GRCm39) R281H probably benign Het
Fndc10 T C 4: 155,779,205 (GRCm39) V83A possibly damaging Het
Galnt2 T A 8: 125,065,202 (GRCm39) I444K probably benign Het
Gcnt3 T C 9: 69,941,290 (GRCm39) Y426C probably damaging Het
Gtpbp1 C T 15: 79,601,855 (GRCm39) R533C probably damaging Het
Hid1 T C 11: 115,252,502 (GRCm39) E60G probably damaging Het
Ighv1-81 A T 12: 115,884,161 (GRCm39) L30Q possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,618,565 (GRCm39) probably null Het
Ilrun A C 17: 28,005,049 (GRCm39) Y169* probably null Het
Klf10 A G 15: 38,298,002 (GRCm39) L44P probably damaging Het
Lamc3 T C 2: 31,813,017 (GRCm39) V1001A probably benign Het
Lamc3 C A 2: 31,818,908 (GRCm39) S1211* probably null Het
Lmx1a T A 1: 167,658,194 (GRCm39) H192Q probably benign Het
Nkx2-4 T C 2: 146,926,184 (GRCm39) H226R possibly damaging Het
Or2d2 T C 7: 106,727,833 (GRCm39) I256V probably benign Het
Or4a68 T A 2: 89,270,276 (GRCm39) M116L probably damaging Het
Or4k37 T C 2: 111,159,297 (GRCm39) F178L probably damaging Het
Or4p18 G A 2: 88,232,586 (GRCm39) R231C probably benign Het
Or5b114-ps1 A T 19: 13,353,004 (GRCm39) N226I unknown Het
Or5p52 T A 7: 107,502,527 (GRCm39) I201N possibly damaging Het
Or7e175 T C 9: 20,048,757 (GRCm39) M115T probably damaging Het
Or8k1 T C 2: 86,047,247 (GRCm39) H269R probably damaging Het
Orai3 G T 7: 127,373,194 (GRCm39) A232S probably benign Het
Pak1ip1 G A 13: 41,162,727 (GRCm39) G177R probably benign Het
Pcp4l1 T C 1: 171,001,975 (GRCm39) R62G possibly damaging Het
Phox2b T A 5: 67,256,064 (GRCm39) Q74L probably benign Het
Pi4kb A G 3: 94,891,797 (GRCm39) Y159C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxna1 T C 6: 89,306,541 (GRCm39) R1430G probably null Het
Plxna4 T C 6: 32,155,315 (GRCm39) H1543R probably benign Het
Prcc A T 3: 87,777,038 (GRCm39) F312Y probably damaging Het
Ranbp6 A G 19: 29,787,388 (GRCm39) L988P probably damaging Het
Rbm27 A G 18: 42,460,572 (GRCm39) T840A probably benign Het
Rchy1 G T 5: 92,105,831 (GRCm39) T39N probably benign Het
Rmi1 C T 13: 58,556,840 (GRCm39) T363I probably benign Het
Rnpc3 A C 3: 113,404,895 (GRCm39) I420S probably damaging Het
Rsph4a T A 10: 33,785,394 (GRCm39) V435E probably benign Het
Rwdd1 T C 10: 33,888,095 (GRCm39) T38A probably damaging Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Sel1l3 T C 5: 53,311,628 (GRCm39) Y619C probably damaging Het
Sf3b3 T C 8: 111,538,658 (GRCm39) T1121A probably damaging Het
Sgk3 T C 1: 9,942,534 (GRCm39) V102A probably benign Het
Sh2b1 T C 7: 126,068,354 (GRCm39) T486A probably damaging Het
Slc22a5 C T 11: 53,766,981 (GRCm39) R169H probably damaging Het
Slc4a5 T C 6: 83,266,223 (GRCm39) V889A possibly damaging Het
Spast C A 17: 74,646,069 (GRCm39) S13* probably null Het
Srek1 T C 13: 103,889,654 (GRCm39) probably null Het
Sugp1 G T 8: 70,509,220 (GRCm39) E164D probably benign Het
Synpo2 T C 3: 122,910,973 (GRCm39) D224G probably benign Het
Tanc1 A G 2: 59,630,432 (GRCm39) D804G probably damaging Het
Tep1 C T 14: 51,081,766 (GRCm39) C1228Y probably damaging Het
Tes T A 6: 17,100,341 (GRCm39) C325S probably benign Het
Themis T C 10: 28,739,390 (GRCm39) V620A probably benign Het
Trim17 T C 11: 58,862,257 (GRCm39) S430P probably damaging Het
Tubgcp5 T C 7: 55,445,693 (GRCm39) I65T possibly damaging Het
Unc13b T C 4: 43,171,955 (GRCm39) S928P unknown Het
Vat1l C T 8: 115,016,172 (GRCm39) A354V probably damaging Het
Vmn1r170 T A 7: 23,306,263 (GRCm39) S222T probably benign Het
Vmn2r112 A T 17: 22,820,213 (GRCm39) M29L probably benign Het
Vmn2r72 T C 7: 85,400,411 (GRCm39) I213V probably benign Het
Wdr89 T A 12: 75,679,564 (GRCm39) Q230L possibly damaging Het
Zfp386 A G 12: 116,023,283 (GRCm39) T334A probably benign Het
Zfp442 T A 2: 150,251,287 (GRCm39) H205L probably benign Het
Zfyve26 A T 12: 79,323,076 (GRCm39) I890N possibly damaging Het
Zic1 T C 9: 91,246,373 (GRCm39) E233G probably damaging Het
Other mutations in Or5b101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Or5b101 APN 19 13,004,955 (GRCm39) missense probably damaging 0.98
IGL01137:Or5b101 APN 19 13,005,394 (GRCm39) missense possibly damaging 0.52
IGL01894:Or5b101 APN 19 13,005,649 (GRCm39) missense probably damaging 1.00
IGL02579:Or5b101 APN 19 13,004,892 (GRCm39) missense probably damaging 0.99
PIT4418001:Or5b101 UTSW 19 13,005,095 (GRCm39) nonsense probably null
R0099:Or5b101 UTSW 19 13,005,165 (GRCm39) missense probably damaging 1.00
R0211:Or5b101 UTSW 19 13,005,646 (GRCm39) missense possibly damaging 0.95
R0211:Or5b101 UTSW 19 13,005,646 (GRCm39) missense possibly damaging 0.95
R0395:Or5b101 UTSW 19 13,005,663 (GRCm39) missense probably damaging 1.00
R0453:Or5b101 UTSW 19 13,005,295 (GRCm39) missense probably damaging 0.97
R0847:Or5b101 UTSW 19 13,005,095 (GRCm39) nonsense probably null
R1227:Or5b101 UTSW 19 13,005,217 (GRCm39) missense probably benign
R1823:Or5b101 UTSW 19 13,005,181 (GRCm39) missense probably benign 0.06
R2509:Or5b101 UTSW 19 13,005,058 (GRCm39) missense probably damaging 1.00
R2899:Or5b101 UTSW 19 13,005,058 (GRCm39) missense probably damaging 1.00
R2964:Or5b101 UTSW 19 13,005,412 (GRCm39) missense probably benign 0.38
R2965:Or5b101 UTSW 19 13,005,412 (GRCm39) missense probably benign 0.38
R3157:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3158:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3409:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3410:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3411:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3425:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R4018:Or5b101 UTSW 19 13,005,189 (GRCm39) missense probably benign
R4668:Or5b101 UTSW 19 13,005,445 (GRCm39) missense probably benign 0.00
R4805:Or5b101 UTSW 19 13,005,661 (GRCm39) missense probably benign 0.04
R5180:Or5b101 UTSW 19 13,004,776 (GRCm39) missense probably benign 0.01
R5391:Or5b101 UTSW 19 13,005,150 (GRCm39) missense probably damaging 1.00
R5557:Or5b101 UTSW 19 13,005,004 (GRCm39) missense probably benign 0.01
R5740:Or5b101 UTSW 19 13,004,926 (GRCm39) missense probably benign 0.24
R7472:Or5b101 UTSW 19 13,005,439 (GRCm39) missense probably benign
R7832:Or5b101 UTSW 19 13,005,360 (GRCm39) missense probably benign 0.02
R7970:Or5b101 UTSW 19 13,005,058 (GRCm39) missense probably damaging 1.00
R8044:Or5b101 UTSW 19 13,004,829 (GRCm39) missense probably damaging 1.00
R8229:Or5b101 UTSW 19 13,005,561 (GRCm39) missense possibly damaging 0.55
R8474:Or5b101 UTSW 19 13,005,357 (GRCm39) missense probably damaging 1.00
R8951:Or5b101 UTSW 19 13,004,827 (GRCm39) missense
R8957:Or5b101 UTSW 19 13,004,881 (GRCm39) missense probably benign 0.03
R9046:Or5b101 UTSW 19 13,005,115 (GRCm39) missense probably benign 0.01
R9059:Or5b101 UTSW 19 13,005,277 (GRCm39) missense probably damaging 1.00
R9131:Or5b101 UTSW 19 13,005,360 (GRCm39) missense probably benign 0.02
R9266:Or5b101 UTSW 19 13,005,648 (GRCm39) missense probably damaging 1.00
Z1088:Or5b101 UTSW 19 13,005,391 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCCTCAGGCTGTAAACCAGAG -3'
(R):5'- ATGGATGCATTAAGTCTCTCCTTC -3'

Sequencing Primer
(F):5'- GGGTTCAACATGCAGATGACC -3'
(R):5'- AAGTCTCTCCTTCTGTGAATCTAATG -3'
Posted On 2022-03-25