Incidental Mutation 'R9270:Eva1c'
ID 702870
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Name eva-1 homolog C
Synonyms 4931408A02Rik, 1700092M14Rik, Fam176c
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R9270 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 90623607-90701997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90701231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 402 (S402P)
Ref Sequence ENSEMBL: ENSMUSP00000097145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231964]
AlphaFold P58659
Predicted Effect probably benign
Transcript: ENSMUST00000037539
AA Change: S396P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: S396P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099543
AA Change: S348P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: S348P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099548
AA Change: S402P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: S402P

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231280
AA Change: S289P

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000231964
AA Change: S301P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (85/85)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 T A 3: 30,652,781 (GRCm39) E104D probably damaging Het
Aig1 T C 10: 13,529,505 (GRCm39) probably null Het
Arih2 A T 9: 108,493,890 (GRCm39) D174E probably damaging Het
Asprv1 T C 6: 86,606,077 (GRCm39) F308L probably damaging Het
Baiap2l2 A G 15: 79,168,205 (GRCm39) probably null Het
Btla T C 16: 45,064,656 (GRCm39) F203L possibly damaging Het
C1rb A T 6: 124,551,947 (GRCm39) D283V probably damaging Het
C87436 C G 6: 86,442,813 (GRCm39) Q462E probably benign Het
Ccdc149 T C 5: 52,563,352 (GRCm39) D147G possibly damaging Het
Chd6 A T 2: 160,871,793 (GRCm39) L214* probably null Het
Chrna4 C A 2: 180,670,643 (GRCm39) R371L possibly damaging Het
Cpne5 A G 17: 29,444,163 (GRCm39) probably null Het
Cr1l T C 1: 194,789,204 (GRCm39) E400G possibly damaging Het
Creb3l2 T C 6: 37,332,583 (GRCm39) N304D probably damaging Het
Cyp17a1 T C 19: 46,656,030 (GRCm39) T420A probably benign Het
Cyp24a1 A G 2: 170,327,853 (GRCm39) I463T probably damaging Het
Cyp3a41b A T 5: 145,514,973 (GRCm39) I84N probably damaging Het
Dnajc6 G A 4: 101,496,559 (GRCm39) V909M possibly damaging Het
Dtl A G 1: 191,288,923 (GRCm39) Y264H probably damaging Het
Dynlt5 A G 4: 102,845,955 (GRCm39) probably null Het
Dysf C T 6: 84,077,216 (GRCm39) R660* probably null Het
Egf A G 3: 129,529,449 (GRCm39) probably null Het
Fcho2 A T 13: 98,925,869 (GRCm39) probably null Het
Fhdc1 G A 3: 84,352,290 (GRCm39) R197C unknown Het
Foxa2 T A 2: 147,886,426 (GRCm39) M136L probably benign Het
Gm10226 T C 17: 21,910,866 (GRCm39) C34R possibly damaging Het
Gm8947 T C 1: 151,068,853 (GRCm39) S229P probably benign Het
Ift56 C T 6: 38,366,109 (GRCm39) probably benign Het
Ighv9-2 A T 12: 114,072,896 (GRCm39) S26T probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kat6a T G 8: 23,420,190 (GRCm39) I745M probably damaging Het
Klhdc1 T C 12: 69,309,968 (GRCm39) L290P probably damaging Het
Lcp2 C T 11: 34,039,688 (GRCm39) T496I Het
Map4k4 T C 1: 40,042,923 (GRCm39) W593R probably benign Het
Mefv T G 16: 3,535,841 (GRCm39) Q29P probably damaging Het
Mgat5b T C 11: 116,859,269 (GRCm39) Y34H Het
Mlip C T 9: 77,137,080 (GRCm39) R609Q probably benign Het
Muc2 A G 7: 141,290,816 (GRCm39) D34G Het
Nbeal1 C T 1: 60,307,548 (GRCm39) P1687S possibly damaging Het
Notch1 T A 2: 26,369,895 (GRCm39) I477L probably damaging Het
Odad2 T A 18: 7,217,846 (GRCm39) K623* probably null Het
Or1l4b G A 2: 37,037,047 (GRCm39) M274I probably benign Het
Or1s2 T C 19: 13,758,333 (GRCm39) V117A probably benign Het
Or4a2 A T 2: 89,248,712 (GRCm39) L15Q probably damaging Het
Or51v8 T A 7: 103,320,124 (GRCm39) N38I probably damaging Het
Or6c214 A G 10: 129,591,148 (GRCm39) M57T probably damaging Het
Pak5 A T 2: 135,958,688 (GRCm39) S133R probably damaging Het
Pcyt1a C A 16: 32,285,332 (GRCm39) D187E probably benign Het
Pdlim7 G T 13: 55,655,354 (GRCm39) T161K probably damaging Het
Phf8-ps A C 17: 33,286,701 (GRCm39) C34G probably damaging Het
Pik3r4 A G 9: 105,547,108 (GRCm39) K962R probably benign Het
Pkd1l2 T C 8: 117,759,433 (GRCm39) K1516E probably damaging Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ptchd3 A T 11: 121,733,180 (GRCm39) Y690F probably benign Het
Ptpn13 A T 5: 103,649,735 (GRCm39) R379S possibly damaging Het
Rbm27 C T 18: 42,438,829 (GRCm39) A410V probably benign Het
Rnase4 A G 14: 51,342,662 (GRCm39) T129A probably benign Het
Serpinb11 C T 1: 107,304,533 (GRCm39) T166I probably benign Het
Shank2 A G 7: 143,963,705 (GRCm39) T438A possibly damaging Het
Slc13a2 T C 11: 78,295,258 (GRCm39) N172D probably damaging Het
Slc2a8 A G 2: 32,864,864 (GRCm39) F428L probably damaging Het
Slc38a6 T C 12: 73,398,544 (GRCm39) M358T probably benign Het
Snx29 A G 16: 11,213,155 (GRCm39) H107R probably benign Het
Spint3 G A 2: 164,415,154 (GRCm39) A21V probably benign Het
Susd1 A T 4: 59,412,226 (GRCm39) V162E probably benign Het
Syne2 T G 12: 75,977,834 (GRCm39) N1426K probably damaging Het
Synj2 T C 17: 6,067,875 (GRCm39) V638A possibly damaging Het
Thada A T 17: 84,538,589 (GRCm39) L1473Q probably damaging Het
Trim36 G A 18: 46,300,580 (GRCm39) S697L possibly damaging Het
Ttbk1 A T 17: 46,781,517 (GRCm39) I412N possibly damaging Het
Tubb2a T C 13: 34,258,578 (GRCm39) D404G probably damaging Het
Tyk2 T A 9: 21,035,841 (GRCm39) N114Y probably damaging Het
Umodl1 A G 17: 31,185,678 (GRCm39) D139G probably damaging Het
Urb2 A G 8: 124,750,192 (GRCm39) probably benign Het
Vmn2r101 T A 17: 19,810,244 (GRCm39) N343K probably benign Het
Vnn1 A G 10: 23,780,464 (GRCm39) D484G probably damaging Het
Vps13b A G 15: 35,770,919 (GRCm39) T2121A probably benign Het
Wdr81 T C 11: 75,345,216 (GRCm39) E17G probably benign Het
Wnk2 T G 13: 49,224,505 (GRCm39) K1117Q probably benign Het
Zbtb46 C T 2: 181,066,138 (GRCm39) R4Q probably benign Het
Zfp608 T A 18: 55,032,190 (GRCm39) K583N probably damaging Het
Zfp729b A T 13: 67,740,480 (GRCm39) L595H probably damaging Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90,701,235 (GRCm39) missense probably damaging 1.00
IGL02061:Eva1c APN 16 90,663,163 (GRCm39) nonsense probably null
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90,672,986 (GRCm39) missense probably benign 0.03
R1330:Eva1c UTSW 16 90,701,284 (GRCm39) missense probably damaging 1.00
R1765:Eva1c UTSW 16 90,701,135 (GRCm39) missense probably benign 0.01
R1824:Eva1c UTSW 16 90,663,331 (GRCm39) missense probably benign 0.01
R1880:Eva1c UTSW 16 90,694,303 (GRCm39) missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90,628,213 (GRCm39) missense probably benign 0.12
R4072:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4076:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4622:Eva1c UTSW 16 90,694,343 (GRCm39) critical splice donor site probably null
R4760:Eva1c UTSW 16 90,701,138 (GRCm39) missense probably benign 0.37
R4767:Eva1c UTSW 16 90,701,235 (GRCm39) missense probably damaging 1.00
R5024:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R5304:Eva1c UTSW 16 90,666,551 (GRCm39) missense probably damaging 1.00
R5559:Eva1c UTSW 16 90,701,139 (GRCm39) missense probably benign 0.06
R6605:Eva1c UTSW 16 90,663,236 (GRCm39) missense probably damaging 1.00
R7222:Eva1c UTSW 16 90,701,072 (GRCm39) small deletion probably benign
R7409:Eva1c UTSW 16 90,666,544 (GRCm39) missense probably damaging 1.00
R7449:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R8489:Eva1c UTSW 16 90,672,999 (GRCm39) missense probably damaging 1.00
R8687:Eva1c UTSW 16 90,687,433 (GRCm39) missense probably benign 0.42
R9091:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCATGTCCAGTGTCTGCATCG -3'
(R):5'- GGACCCTTCCTTCTTCAGAGAG -3'

Sequencing Primer
(F):5'- AGTGTCTGCATCGGCCTG -3'
(R):5'- AGAGAGTCTGATCTCCTCCAGATG -3'
Posted On 2022-03-25