Incidental Mutation 'R9270:Itpr3'
ID 702874
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9270 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 27118677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]
AlphaFold P70227
Predicted Effect probably benign
Transcript: ENSMUST00000025045
Predicted Effect probably null
Transcript: ENSMUST00000049308
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118613
Predicted Effect probably benign
Transcript: ENSMUST00000119227
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,727 C34G probably damaging Het
Actrt3 T A 3: 30,598,632 E104D probably damaging Het
Aig1 T C 10: 13,653,761 probably null Het
Arih2 A T 9: 108,616,691 D174E probably damaging Het
Armc4 T A 18: 7,217,846 K623* probably null Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Baiap2l2 A G 15: 79,284,005 probably null Het
Btla T C 16: 45,244,293 F203L possibly damaging Het
C1rb A T 6: 124,574,988 D283V probably damaging Het
C87436 C G 6: 86,465,831 Q462E probably benign Het
Ccdc149 T C 5: 52,406,010 D147G possibly damaging Het
Chd6 A T 2: 161,029,873 L214* probably null Het
Chrna4 C A 2: 181,028,850 R371L possibly damaging Het
Cpne5 A G 17: 29,225,189 probably null Het
Cr1l T C 1: 195,106,896 E400G possibly damaging Het
Creb3l2 T C 6: 37,355,648 N304D probably damaging Het
Cyp17a1 T C 19: 46,667,591 T420A probably benign Het
Cyp24a1 A G 2: 170,485,933 I463T probably damaging Het
Cyp3a41b A T 5: 145,578,163 I84N probably damaging Het
Dnajc6 G A 4: 101,639,362 V909M possibly damaging Het
Dtl A G 1: 191,556,811 Y264H probably damaging Het
Dysf C T 6: 84,100,234 R660* probably null Het
Egf A G 3: 129,735,800 probably null Het
Eva1c T C 16: 90,904,343 S402P probably benign Het
Fcho2 A T 13: 98,789,361 probably null Het
Fhdc1 G A 3: 84,444,983 R197C unknown Het
Foxa2 T A 2: 148,044,506 M136L probably benign Het
Gm10226 T C 17: 21,691,959 C34R possibly damaging Het
Gm8947 T C 1: 151,193,102 S229P probably benign Het
Ighv9-2 A T 12: 114,109,276 S26T probably damaging Het
Kat6a T G 8: 22,930,174 I745M probably damaging Het
Klhdc1 T C 12: 69,263,194 L290P probably damaging Het
Lcp2 C T 11: 34,089,688 T496I Het
Map4k4 T C 1: 40,003,763 W593R probably benign Het
Mefv T G 16: 3,717,977 Q29P probably damaging Het
Mgat5b T C 11: 116,968,443 Y34H Het
Mlip C T 9: 77,229,798 R609Q probably benign Het
Muc2 A G 7: 141,704,267 D34G Het
Nbeal1 C T 1: 60,268,389 P1687S possibly damaging Het
Notch1 T A 2: 26,479,883 I477L probably damaging Het
Olfr1239 A T 2: 89,418,368 L15Q probably damaging Het
Olfr1496 T C 19: 13,780,969 V117A probably benign Het
Olfr364-ps1 G A 2: 37,147,035 M274I probably benign Het
Olfr624 T A 7: 103,670,917 N38I probably damaging Het
Olfr807 A G 10: 129,755,279 M57T probably damaging Het
Pak7 A T 2: 136,116,768 S133R probably damaging Het
Pcyt1a C A 16: 32,466,514 D187E probably benign Het
Pdlim7 G T 13: 55,507,541 T161K probably damaging Het
Pik3r4 A G 9: 105,669,909 K962R probably benign Het
Pkd1l2 T C 8: 117,032,694 K1516E probably damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ptchd3 A T 11: 121,842,354 Y690F probably benign Het
Ptpn13 A T 5: 103,501,869 R379S possibly damaging Het
Rbm27 C T 18: 42,305,764 A410V probably benign Het
Rnase4 A G 14: 51,105,205 T129A probably benign Het
Serpinb11 C T 1: 107,376,803 T166I probably benign Het
Shank2 A G 7: 144,409,968 T438A possibly damaging Het
Slc13a2 T C 11: 78,404,432 N172D probably damaging Het
Slc2a8 A G 2: 32,974,852 F428L probably damaging Het
Slc38a6 T C 12: 73,351,770 M358T probably benign Het
Snx29 A G 16: 11,395,291 H107R probably benign Het
Spint3 G A 2: 164,573,234 A21V probably benign Het
Susd1 A T 4: 59,412,226 V162E probably benign Het
Syne2 T G 12: 75,931,060 N1426K probably damaging Het
Synj2 T C 17: 6,017,600 V638A possibly damaging Het
Tctex1d1 A G 4: 102,988,758 probably null Het
Thada A T 17: 84,231,161 L1473Q probably damaging Het
Trim36 G A 18: 46,167,513 S697L possibly damaging Het
Ttbk1 A T 17: 46,470,591 I412N possibly damaging Het
Ttc26 C T 6: 38,389,174 probably benign Het
Tubb2a T C 13: 34,074,595 D404G probably damaging Het
Tyk2 T A 9: 21,124,545 N114Y probably damaging Het
Umodl1 A G 17: 30,966,704 D139G probably damaging Het
Urb2 A G 8: 124,023,453 probably benign Het
Vmn2r101 T A 17: 19,589,982 N343K probably benign Het
Vnn1 A G 10: 23,904,566 D484G probably damaging Het
Vps13b A G 15: 35,770,773 T2121A probably benign Het
Wdr81 T C 11: 75,454,390 E17G probably benign Het
Wnk2 T G 13: 49,071,029 K1117Q probably benign Het
Zbtb46 C T 2: 181,424,345 R4Q probably benign Het
Zfp608 T A 18: 54,899,118 K583N probably damaging Het
Zfp729b A T 13: 67,592,361 L595H probably damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27118677 unclassified probably benign
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9294:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9477:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
R9694:Itpr3 UTSW 17 27115953 missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27089941 missense probably benign 0.15
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTGAGATCCTAGAAGGTGAGAC -3'
(R):5'- GAAGCCACTGACTGCTGATG -3'

Sequencing Primer
(F):5'- ACCGGCGTCTACAGGATAG -3'
(R):5'- ACTGACTGCTGATGGCCCAC -3'
Posted On 2022-03-25