Incidental Mutation 'R9270:Umodl1'
ID 702876
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9270 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 30954679-31010708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30966704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: D139G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: D139G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: D139G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: D139G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: D139G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: D139G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.2894 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,727 C34G probably damaging Het
Actrt3 T A 3: 30,598,632 E104D probably damaging Het
Aig1 T C 10: 13,653,761 probably null Het
Arih2 A T 9: 108,616,691 D174E probably damaging Het
Armc4 T A 18: 7,217,846 K623* probably null Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Baiap2l2 A G 15: 79,284,005 probably null Het
Btla T C 16: 45,244,293 F203L possibly damaging Het
C1rb A T 6: 124,574,988 D283V probably damaging Het
C87436 C G 6: 86,465,831 Q462E probably benign Het
Ccdc149 T C 5: 52,406,010 D147G possibly damaging Het
Chd6 A T 2: 161,029,873 L214* probably null Het
Chrna4 C A 2: 181,028,850 R371L possibly damaging Het
Cpne5 A G 17: 29,225,189 probably null Het
Cr1l T C 1: 195,106,896 E400G possibly damaging Het
Creb3l2 T C 6: 37,355,648 N304D probably damaging Het
Cyp17a1 T C 19: 46,667,591 T420A probably benign Het
Cyp24a1 A G 2: 170,485,933 I463T probably damaging Het
Cyp3a41b A T 5: 145,578,163 I84N probably damaging Het
Dnajc6 G A 4: 101,639,362 V909M possibly damaging Het
Dtl A G 1: 191,556,811 Y264H probably damaging Het
Dysf C T 6: 84,100,234 R660* probably null Het
Egf A G 3: 129,735,800 probably null Het
Eva1c T C 16: 90,904,343 S402P probably benign Het
Fcho2 A T 13: 98,789,361 probably null Het
Fhdc1 G A 3: 84,444,983 R197C unknown Het
Foxa2 T A 2: 148,044,506 M136L probably benign Het
Gm10226 T C 17: 21,691,959 C34R possibly damaging Het
Gm8947 T C 1: 151,193,102 S229P probably benign Het
Ighv9-2 A T 12: 114,109,276 S26T probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kat6a T G 8: 22,930,174 I745M probably damaging Het
Klhdc1 T C 12: 69,263,194 L290P probably damaging Het
Lcp2 C T 11: 34,089,688 T496I Het
Map4k4 T C 1: 40,003,763 W593R probably benign Het
Mefv T G 16: 3,717,977 Q29P probably damaging Het
Mgat5b T C 11: 116,968,443 Y34H Het
Mlip C T 9: 77,229,798 R609Q probably benign Het
Muc2 A G 7: 141,704,267 D34G Het
Nbeal1 C T 1: 60,268,389 P1687S possibly damaging Het
Notch1 T A 2: 26,479,883 I477L probably damaging Het
Olfr1239 A T 2: 89,418,368 L15Q probably damaging Het
Olfr1496 T C 19: 13,780,969 V117A probably benign Het
Olfr364-ps1 G A 2: 37,147,035 M274I probably benign Het
Olfr624 T A 7: 103,670,917 N38I probably damaging Het
Olfr807 A G 10: 129,755,279 M57T probably damaging Het
Pak7 A T 2: 136,116,768 S133R probably damaging Het
Pcyt1a C A 16: 32,466,514 D187E probably benign Het
Pdlim7 G T 13: 55,507,541 T161K probably damaging Het
Pik3r4 A G 9: 105,669,909 K962R probably benign Het
Pkd1l2 T C 8: 117,032,694 K1516E probably damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ptchd3 A T 11: 121,842,354 Y690F probably benign Het
Ptpn13 A T 5: 103,501,869 R379S possibly damaging Het
Rbm27 C T 18: 42,305,764 A410V probably benign Het
Rnase4 A G 14: 51,105,205 T129A probably benign Het
Serpinb11 C T 1: 107,376,803 T166I probably benign Het
Shank2 A G 7: 144,409,968 T438A possibly damaging Het
Slc13a2 T C 11: 78,404,432 N172D probably damaging Het
Slc2a8 A G 2: 32,974,852 F428L probably damaging Het
Slc38a6 T C 12: 73,351,770 M358T probably benign Het
Snx29 A G 16: 11,395,291 H107R probably benign Het
Spint3 G A 2: 164,573,234 A21V probably benign Het
Susd1 A T 4: 59,412,226 V162E probably benign Het
Syne2 T G 12: 75,931,060 N1426K probably damaging Het
Synj2 T C 17: 6,017,600 V638A possibly damaging Het
Tctex1d1 A G 4: 102,988,758 probably null Het
Thada A T 17: 84,231,161 L1473Q probably damaging Het
Trim36 G A 18: 46,167,513 S697L possibly damaging Het
Ttbk1 A T 17: 46,470,591 I412N possibly damaging Het
Ttc26 C T 6: 38,389,174 probably benign Het
Tubb2a T C 13: 34,074,595 D404G probably damaging Het
Tyk2 T A 9: 21,124,545 N114Y probably damaging Het
Urb2 A G 8: 124,023,453 probably benign Het
Vmn2r101 T A 17: 19,589,982 N343K probably benign Het
Vnn1 A G 10: 23,904,566 D484G probably damaging Het
Vps13b A G 15: 35,770,773 T2121A probably benign Het
Wdr81 T C 11: 75,454,390 E17G probably benign Het
Wnk2 T G 13: 49,071,029 K1117Q probably benign Het
Zbtb46 C T 2: 181,424,345 R4Q probably benign Het
Zfp608 T A 18: 54,899,118 K583N probably damaging Het
Zfp729b A T 13: 67,592,361 L595H probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 30973703 missense probably damaging 1.00
R9091:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9099:Umodl1 UTSW 17 30959173 missense probably benign 0.01
R9341:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 30996393 missense probably damaging 0.99
R9569:Umodl1 UTSW 17 30998169 missense probably damaging 1.00
R9615:Umodl1 UTSW 17 30998178 missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 30959350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCAATTAGGGTTGATGCCTT -3'
(R):5'- CAGGGCTCTAGGGACCAC -3'

Sequencing Primer
(F):5'- GTACTAGGAACTGAACCTTGGTCC -3'
(R):5'- CGTGGGGACAGGCAGAC -3'
Posted On 2022-03-25