Mutagenetix > Incidental Mutation

Incidental Mutation 'R9270:Umodl1'

702876

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30966704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 139 (D139G)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: D139G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: D139G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066981
AA Change: D139G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: D139G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: D139G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: D139G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Meta Mutation Damage Score

0.2894

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (85/85)

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,727	C34G	probably damaging	Het
Actrt3	T	A	3: 30,598,632	E104D	probably damaging	Het
Aig1	T	C	10: 13,653,761		probably null	Het
Arih2	A	T	9: 108,616,691	D174E	probably damaging	Het
Armc4	T	A	18: 7,217,846	K623*	probably null	Het
Asprv1	T	C	6: 86,629,095	F308L	probably damaging	Het
Baiap2l2	A	G	15: 79,284,005		probably null	Het
Btla	T	C	16: 45,244,293	F203L	possibly damaging	Het
C1rb	A	T	6: 124,574,988	D283V	probably damaging	Het
C87436	C	G	6: 86,465,831	Q462E	probably benign	Het
Ccdc149	T	C	5: 52,406,010	D147G	possibly damaging	Het
Chd6	A	T	2: 161,029,873	L214*	probably null	Het
Chrna4	C	A	2: 181,028,850	R371L	possibly damaging	Het
Cpne5	A	G	17: 29,225,189		probably null	Het
Cr1l	T	C	1: 195,106,896	E400G	possibly damaging	Het
Creb3l2	T	C	6: 37,355,648	N304D	probably damaging	Het
Cyp17a1	T	C	19: 46,667,591	T420A	probably benign	Het
Cyp24a1	A	G	2: 170,485,933	I463T	probably damaging	Het
Cyp3a41b	A	T	5: 145,578,163	I84N	probably damaging	Het
Dnajc6	G	A	4: 101,639,362	V909M	possibly damaging	Het
Dtl	A	G	1: 191,556,811	Y264H	probably damaging	Het
Dysf	C	T	6: 84,100,234	R660*	probably null	Het
Egf	A	G	3: 129,735,800		probably null	Het
Eva1c	T	C	16: 90,904,343	S402P	probably benign	Het
Fcho2	A	T	13: 98,789,361		probably null	Het
Fhdc1	G	A	3: 84,444,983	R197C	unknown	Het
Foxa2	T	A	2: 148,044,506	M136L	probably benign	Het
Gm10226	T	C	17: 21,691,959	C34R	possibly damaging	Het
Gm8947	T	C	1: 151,193,102	S229P	probably benign	Het
Ighv9-2	A	T	12: 114,109,276	S26T	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kat6a	T	G	8: 22,930,174	I745M	probably damaging	Het
Klhdc1	T	C	12: 69,263,194	L290P	probably damaging	Het
Lcp2	C	T	11: 34,089,688	T496I		Het
Map4k4	T	C	1: 40,003,763	W593R	probably benign	Het
Mefv	T	G	16: 3,717,977	Q29P	probably damaging	Het
Mgat5b	T	C	11: 116,968,443	Y34H		Het
Mlip	C	T	9: 77,229,798	R609Q	probably benign	Het
Muc2	A	G	7: 141,704,267	D34G		Het
Nbeal1	C	T	1: 60,268,389	P1687S	possibly damaging	Het
Notch1	T	A	2: 26,479,883	I477L	probably damaging	Het
Olfr1239	A	T	2: 89,418,368	L15Q	probably damaging	Het
Olfr1496	T	C	19: 13,780,969	V117A	probably benign	Het
Olfr364-ps1	G	A	2: 37,147,035	M274I	probably benign	Het
Olfr624	T	A	7: 103,670,917	N38I	probably damaging	Het
Olfr807	A	G	10: 129,755,279	M57T	probably damaging	Het
Pak7	A	T	2: 136,116,768	S133R	probably damaging	Het
Pcyt1a	C	A	16: 32,466,514	D187E	probably benign	Het
Pdlim7	G	T	13: 55,507,541	T161K	probably damaging	Het
Pik3r4	A	G	9: 105,669,909	K962R	probably benign	Het
Pkd1l2	T	C	8: 117,032,694	K1516E	probably damaging	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ptchd3	A	T	11: 121,842,354	Y690F	probably benign	Het
Ptpn13	A	T	5: 103,501,869	R379S	possibly damaging	Het
Rbm27	C	T	18: 42,305,764	A410V	probably benign	Het
Rnase4	A	G	14: 51,105,205	T129A	probably benign	Het
Serpinb11	C	T	1: 107,376,803	T166I	probably benign	Het
Shank2	A	G	7: 144,409,968	T438A	possibly damaging	Het
Slc13a2	T	C	11: 78,404,432	N172D	probably damaging	Het
Slc2a8	A	G	2: 32,974,852	F428L	probably damaging	Het
Slc38a6	T	C	12: 73,351,770	M358T	probably benign	Het
Snx29	A	G	16: 11,395,291	H107R	probably benign	Het
Spint3	G	A	2: 164,573,234	A21V	probably benign	Het
Susd1	A	T	4: 59,412,226	V162E	probably benign	Het
Syne2	T	G	12: 75,931,060	N1426K	probably damaging	Het
Synj2	T	C	17: 6,017,600	V638A	possibly damaging	Het
Tctex1d1	A	G	4: 102,988,758		probably null	Het
Thada	A	T	17: 84,231,161	L1473Q	probably damaging	Het
Trim36	G	A	18: 46,167,513	S697L	possibly damaging	Het
Ttbk1	A	T	17: 46,470,591	I412N	possibly damaging	Het
Ttc26	C	T	6: 38,389,174		probably benign	Het
Tubb2a	T	C	13: 34,074,595	D404G	probably damaging	Het
Tyk2	T	A	9: 21,124,545	N114Y	probably damaging	Het
Urb2	A	G	8: 124,023,453		probably benign	Het
Vmn2r101	T	A	17: 19,589,982	N343K	probably benign	Het
Vnn1	A	G	10: 23,904,566	D484G	probably damaging	Het
Vps13b	A	G	15: 35,770,773	T2121A	probably benign	Het
Wdr81	T	C	11: 75,454,390	E17G	probably benign	Het
Wnk2	T	G	13: 49,071,029	K1117Q	probably benign	Het
Zbtb46	C	T	2: 181,424,345	R4Q	probably benign	Het
Zfp608	T	A	18: 54,899,118	K583N	probably damaging	Het
Zfp729b	A	T	13: 67,592,361	L595H	probably damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCAATTAGGGTTGATGCCTT -3'
(R):5'- CAGGGCTCTAGGGACCAC -3'

Sequencing Primer
(F):5'- GTACTAGGAACTGAACCTTGGTCC -3'
(R):5'- CGTGGGGACAGGCAGAC -3'

Posted On

2022-03-25