Incidental Mutation 'R9270:Cyp17a1'
ID 702885
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R9270 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46656030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 420 (T420A)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: T420A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: T420A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 T A 3: 30,652,781 (GRCm39) E104D probably damaging Het
Aig1 T C 10: 13,529,505 (GRCm39) probably null Het
Arih2 A T 9: 108,493,890 (GRCm39) D174E probably damaging Het
Asprv1 T C 6: 86,606,077 (GRCm39) F308L probably damaging Het
Baiap2l2 A G 15: 79,168,205 (GRCm39) probably null Het
Btla T C 16: 45,064,656 (GRCm39) F203L possibly damaging Het
C1rb A T 6: 124,551,947 (GRCm39) D283V probably damaging Het
C87436 C G 6: 86,442,813 (GRCm39) Q462E probably benign Het
Ccdc149 T C 5: 52,563,352 (GRCm39) D147G possibly damaging Het
Chd6 A T 2: 160,871,793 (GRCm39) L214* probably null Het
Chrna4 C A 2: 180,670,643 (GRCm39) R371L possibly damaging Het
Cpne5 A G 17: 29,444,163 (GRCm39) probably null Het
Cr1l T C 1: 194,789,204 (GRCm39) E400G possibly damaging Het
Creb3l2 T C 6: 37,332,583 (GRCm39) N304D probably damaging Het
Cyp24a1 A G 2: 170,327,853 (GRCm39) I463T probably damaging Het
Cyp3a41b A T 5: 145,514,973 (GRCm39) I84N probably damaging Het
Dnajc6 G A 4: 101,496,559 (GRCm39) V909M possibly damaging Het
Dtl A G 1: 191,288,923 (GRCm39) Y264H probably damaging Het
Dynlt5 A G 4: 102,845,955 (GRCm39) probably null Het
Dysf C T 6: 84,077,216 (GRCm39) R660* probably null Het
Egf A G 3: 129,529,449 (GRCm39) probably null Het
Eva1c T C 16: 90,701,231 (GRCm39) S402P probably benign Het
Fcho2 A T 13: 98,925,869 (GRCm39) probably null Het
Fhdc1 G A 3: 84,352,290 (GRCm39) R197C unknown Het
Foxa2 T A 2: 147,886,426 (GRCm39) M136L probably benign Het
Gm10226 T C 17: 21,910,866 (GRCm39) C34R possibly damaging Het
Gm8947 T C 1: 151,068,853 (GRCm39) S229P probably benign Het
Ift56 C T 6: 38,366,109 (GRCm39) probably benign Het
Ighv9-2 A T 12: 114,072,896 (GRCm39) S26T probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kat6a T G 8: 23,420,190 (GRCm39) I745M probably damaging Het
Klhdc1 T C 12: 69,309,968 (GRCm39) L290P probably damaging Het
Lcp2 C T 11: 34,039,688 (GRCm39) T496I Het
Map4k4 T C 1: 40,042,923 (GRCm39) W593R probably benign Het
Mefv T G 16: 3,535,841 (GRCm39) Q29P probably damaging Het
Mgat5b T C 11: 116,859,269 (GRCm39) Y34H Het
Mlip C T 9: 77,137,080 (GRCm39) R609Q probably benign Het
Muc2 A G 7: 141,290,816 (GRCm39) D34G Het
Nbeal1 C T 1: 60,307,548 (GRCm39) P1687S possibly damaging Het
Notch1 T A 2: 26,369,895 (GRCm39) I477L probably damaging Het
Odad2 T A 18: 7,217,846 (GRCm39) K623* probably null Het
Or1l4b G A 2: 37,037,047 (GRCm39) M274I probably benign Het
Or1s2 T C 19: 13,758,333 (GRCm39) V117A probably benign Het
Or4a2 A T 2: 89,248,712 (GRCm39) L15Q probably damaging Het
Or51v8 T A 7: 103,320,124 (GRCm39) N38I probably damaging Het
Or6c214 A G 10: 129,591,148 (GRCm39) M57T probably damaging Het
Pak5 A T 2: 135,958,688 (GRCm39) S133R probably damaging Het
Pcyt1a C A 16: 32,285,332 (GRCm39) D187E probably benign Het
Pdlim7 G T 13: 55,655,354 (GRCm39) T161K probably damaging Het
Phf8-ps A C 17: 33,286,701 (GRCm39) C34G probably damaging Het
Pik3r4 A G 9: 105,547,108 (GRCm39) K962R probably benign Het
Pkd1l2 T C 8: 117,759,433 (GRCm39) K1516E probably damaging Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ptchd3 A T 11: 121,733,180 (GRCm39) Y690F probably benign Het
Ptpn13 A T 5: 103,649,735 (GRCm39) R379S possibly damaging Het
Rbm27 C T 18: 42,438,829 (GRCm39) A410V probably benign Het
Rnase4 A G 14: 51,342,662 (GRCm39) T129A probably benign Het
Serpinb11 C T 1: 107,304,533 (GRCm39) T166I probably benign Het
Shank2 A G 7: 143,963,705 (GRCm39) T438A possibly damaging Het
Slc13a2 T C 11: 78,295,258 (GRCm39) N172D probably damaging Het
Slc2a8 A G 2: 32,864,864 (GRCm39) F428L probably damaging Het
Slc38a6 T C 12: 73,398,544 (GRCm39) M358T probably benign Het
Snx29 A G 16: 11,213,155 (GRCm39) H107R probably benign Het
Spint3 G A 2: 164,415,154 (GRCm39) A21V probably benign Het
Susd1 A T 4: 59,412,226 (GRCm39) V162E probably benign Het
Syne2 T G 12: 75,977,834 (GRCm39) N1426K probably damaging Het
Synj2 T C 17: 6,067,875 (GRCm39) V638A possibly damaging Het
Thada A T 17: 84,538,589 (GRCm39) L1473Q probably damaging Het
Trim36 G A 18: 46,300,580 (GRCm39) S697L possibly damaging Het
Ttbk1 A T 17: 46,781,517 (GRCm39) I412N possibly damaging Het
Tubb2a T C 13: 34,258,578 (GRCm39) D404G probably damaging Het
Tyk2 T A 9: 21,035,841 (GRCm39) N114Y probably damaging Het
Umodl1 A G 17: 31,185,678 (GRCm39) D139G probably damaging Het
Urb2 A G 8: 124,750,192 (GRCm39) probably benign Het
Vmn2r101 T A 17: 19,810,244 (GRCm39) N343K probably benign Het
Vnn1 A G 10: 23,780,464 (GRCm39) D484G probably damaging Het
Vps13b A G 15: 35,770,919 (GRCm39) T2121A probably benign Het
Wdr81 T C 11: 75,345,216 (GRCm39) E17G probably benign Het
Wnk2 T G 13: 49,224,505 (GRCm39) K1117Q probably benign Het
Zbtb46 C T 2: 181,066,138 (GRCm39) R4Q probably benign Het
Zfp608 T A 18: 55,032,190 (GRCm39) K583N probably damaging Het
Zfp729b A T 13: 67,740,480 (GRCm39) L595H probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGATCAGAAAGACCACCTTGG -3'
(R):5'- TGTAGGCATCTGTCTCCCAAG -3'

Sequencing Primer
(F):5'- ACCACCTTGGGGTCACC -3'
(R):5'- ATCTGTCTCCCAAGAGGCCTG -3'
Posted On 2022-03-25