Incidental Mutation 'R0750:Hs6st3'
ID70289
Institutional Source Beutler Lab
Gene Symbol Hs6st3
Ensembl Gene ENSMUSG00000053465
Gene Nameheparan sulfate 6-O-sulfotransferase 3
Synonyms6OST3
MMRRC Submission 038930-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R0750 (G1)
Quality Score116
Status Not validated
Chromosome14
Chromosomal Location119138341-119869815 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CGGAGGAGGAGGAGGAGGA to CGGAGGAGGAGGAGGA at 119138707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065904]
Predicted Effect probably benign
Transcript: ENSMUST00000065904
SMART Domains Protein: ENSMUSP00000070394
Gene: ENSMUSG00000053465

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 86 115 N/A INTRINSIC
Pfam:Sulfotransfer_2 137 410 4.7e-83 PFAM
low complexity region 425 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate (HS) sulfotransferases, such as HS6ST3, modify HS to generate structures required for interactions between HS and a variety of proteins. These interactions are implicated in proliferation and differentiation, adhesion, migration, inflammation, blood coagulation, and other diverse processes (Habuchi et al., 2000 [PubMed 10644753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A T 4: 156,166,937 L1974* probably null Het
Brd4 T C 17: 32,220,252 E418G probably benign Het
Brip1 G A 11: 86,061,499 S1152L possibly damaging Het
Btrc T G 19: 45,503,146 F81C probably damaging Het
C87499 A G 4: 88,627,668 F479S probably benign Het
Cep85l A G 10: 53,281,546 L585P probably damaging Het
Cfap46 T G 7: 139,654,670 E671D probably damaging Het
Dsg1a T C 18: 20,340,153 L761P probably benign Het
Ece2 G T 16: 20,633,050 V396L probably benign Het
Fam71a G A 1: 191,164,485 probably benign Het
Id2 A G 12: 25,095,671 S114P probably damaging Het
Igf1r T C 7: 68,212,091 F1133S probably damaging Het
Izumo1 T C 7: 45,626,283 probably null Het
Krt35 A G 11: 100,096,153 S12P possibly damaging Het
Olfr76 T C 19: 12,120,713 probably null Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Tmed6 T C 8: 107,061,769 Y182C possibly damaging Het
Tmem174 G T 13: 98,637,279 N14K probably damaging Het
Tmem87b T C 2: 128,818,436 L33P possibly damaging Het
Vmn1r16 T C 6: 57,322,827 Y270C probably benign Het
Vps37d A T 5: 135,074,440 L116Q possibly damaging Het
Zfp592 A G 7: 81,024,745 S486G probably benign Het
Other mutations in Hs6st3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Hs6st3 APN 14 119139034 missense probably damaging 1.00
IGL00973:Hs6st3 APN 14 119869407 missense possibly damaging 0.58
IGL02185:Hs6st3 APN 14 119868884 critical splice acceptor site probably null
IGL02696:Hs6st3 APN 14 119869319 missense probably damaging 0.98
IGL02820:Hs6st3 APN 14 119139080 missense possibly damaging 0.95
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0634:Hs6st3 UTSW 14 119869062 nonsense probably null
R0737:Hs6st3 UTSW 14 119869383 missense possibly damaging 0.82
R1975:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R1977:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R2025:Hs6st3 UTSW 14 119869389 missense probably damaging 1.00
R2116:Hs6st3 UTSW 14 119869287 missense probably damaging 1.00
R2295:Hs6st3 UTSW 14 119138445 missense probably benign 0.15
R3154:Hs6st3 UTSW 14 119868977 missense probably damaging 0.99
R5700:Hs6st3 UTSW 14 119138787 nonsense probably null
R5744:Hs6st3 UTSW 14 119138440 missense possibly damaging 0.96
R5852:Hs6st3 UTSW 14 119869326 missense probably damaging 1.00
R5861:Hs6st3 UTSW 14 119138853 missense possibly damaging 0.89
R6262:Hs6st3 UTSW 14 119138991 missense possibly damaging 0.95
R6408:Hs6st3 UTSW 14 119138634 missense probably benign 0.44
R7140:Hs6st3 UTSW 14 119139102 missense probably damaging 1.00
R7598:Hs6st3 UTSW 14 119869338 missense probably damaging 1.00
R8026:Hs6st3 UTSW 14 119869556 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCCCCGAAACTTCCGAGCAG -3'
(R):5'- TGTGCAGGAACACGATCACATCC -3'

Sequencing Primer
(F):5'- TCGTGGTCATCATGTACCAG -3'
(R):5'- GATCACATCCCGCCCTTTG -3'
Posted On2013-09-30