Incidental Mutation 'R9271:Dnah14'
ID 702895
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9271 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181597325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 3549 (N3549I)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: N3549I

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,901,940 (GRCm39) S819T probably damaging Het
Abca13 A T 11: 9,241,698 (GRCm39) D1187V probably damaging Het
Ak9 C A 10: 41,300,623 (GRCm39) T1611K unknown Het
Als2 G T 1: 59,242,189 (GRCm39) T622K probably benign Het
Ankrd40 G A 11: 94,225,262 (GRCm39) A98T probably benign Het
Ap1b1 T C 11: 4,973,174 (GRCm39) L339P probably damaging Het
Appl1 A C 14: 26,669,084 (GRCm39) H363Q probably benign Het
Atf6 T C 1: 170,622,245 (GRCm39) N459D probably damaging Het
Ccdc6 A T 10: 70,024,993 (GRCm39) Q432L unknown Het
Ccl21a T A 4: 42,773,486 (GRCm39) Q84L probably damaging Het
Cct4 A G 11: 22,951,389 (GRCm39) I348V probably benign Het
Cd300ld2 A G 11: 114,904,550 (GRCm39) Y106H probably damaging Het
Cdh19 C T 1: 110,876,947 (GRCm39) E131K probably damaging Het
Cdon A G 9: 35,403,175 (GRCm39) D1095G probably damaging Het
Cep85l T A 10: 53,157,670 (GRCm39) R678* probably null Het
Chst3 T A 10: 60,021,465 (GRCm39) S461C probably damaging Het
Clk1 A G 1: 58,459,312 (GRCm39) I149T possibly damaging Het
Clvs2 T A 10: 33,389,301 (GRCm39) D313V possibly damaging Het
Dap3 T C 3: 88,840,913 (GRCm39) T75A probably benign Het
Dnaaf1 T A 8: 120,324,392 (GRCm39) F631L probably benign Het
Dnah17 A T 11: 117,931,870 (GRCm39) Y3701N probably damaging Het
Dock6 A G 9: 21,752,796 (GRCm39) V339A possibly damaging Het
Dpp6 T A 5: 27,803,832 (GRCm39) C259* probably null Het
Dqx1 A G 6: 83,036,024 (GRCm39) T119A probably benign Het
Dync1h1 G T 12: 110,583,310 (GRCm39) R469L probably benign Het
Eno4 C T 19: 58,951,260 (GRCm39) A424V probably benign Het
Entrep1 A T 19: 23,972,221 (GRCm39) I161N possibly damaging Het
Fads1 T A 19: 10,163,162 (GRCm39) D146E probably damaging Het
Fam171a1 C T 2: 3,224,543 (GRCm39) T303M probably damaging Het
Fbxw20 C T 9: 109,050,423 (GRCm39) D401N probably benign Het
Fcho1 T A 8: 72,163,068 (GRCm39) T654S possibly damaging Het
Flad1 C A 3: 89,315,858 (GRCm39) E235* probably null Het
Flrt2 G T 12: 95,745,907 (GRCm39) A82S probably benign Het
Gabrg3 A T 7: 56,829,386 (GRCm39) S124T probably benign Het
Galt C T 4: 41,756,777 (GRCm39) T139I probably benign Het
Garin4 A G 1: 190,895,153 (GRCm39) S497P probably damaging Het
Gfod1 T C 13: 43,456,861 (GRCm39) E38G possibly damaging Het
Gm10330 A G 12: 23,829,992 (GRCm39) I63T possibly damaging Het
Gm3033 A T 14: 3,846,968 (GRCm38) N28I Het
Gm49359 A G 13: 62,602,867 (GRCm39) V111A probably benign Het
Gpank1 C T 17: 35,340,734 (GRCm39) probably benign Het
Hck T C 2: 152,973,185 (GRCm39) L156P probably damaging Het
Hcn3 G T 3: 89,057,267 (GRCm39) R444S probably damaging Het
Hephl1 T C 9: 14,988,236 (GRCm39) N624S probably damaging Het
Hmcn1 A G 1: 150,632,309 (GRCm39) I876T probably damaging Het
Itga9 T A 9: 118,500,859 (GRCm39) D377E possibly damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Itprid1 G T 6: 55,944,051 (GRCm39) R417L probably benign Het
Kcnk1 T A 8: 126,752,152 (GRCm39) probably null Het
Klk1b11 C T 7: 43,425,954 (GRCm39) L32F probably benign Het
Lta4h A G 10: 93,310,412 (GRCm39) S427G probably benign Het
Lxn T A 3: 67,368,651 (GRCm39) I122F probably damaging Het
Lyz1 A G 10: 117,124,492 (GRCm39) V148A possibly damaging Het
Mael G T 1: 166,032,424 (GRCm39) Q326K probably benign Het
Magi3 T C 3: 103,923,264 (GRCm39) D1151G possibly damaging Het
Map3k9 C A 12: 81,769,261 (GRCm39) G929V probably benign Het
Mcoln1 A G 8: 3,555,771 (GRCm39) Y22C probably damaging Het
Mier3 G T 13: 111,827,870 (GRCm39) M45I probably benign Het
Mrpl1 T C 5: 96,371,746 (GRCm39) V91A probably damaging Het
Msra T C 14: 64,471,269 (GRCm39) probably null Het
Myo7a T C 7: 97,740,281 (GRCm39) H571R probably benign Het
Myom1 T A 17: 71,374,325 (GRCm39) W601R probably damaging Het
Myom3 C T 4: 135,505,479 (GRCm39) T456I probably benign Het
Nags A T 11: 102,037,584 (GRCm39) H225L probably benign Het
Ncaph C A 2: 126,958,554 (GRCm39) K488N probably damaging Het
Nkain3 C T 4: 20,484,897 (GRCm39) R60H probably damaging Het
Nlrp9a A T 7: 26,261,944 (GRCm39) M698L probably benign Het
Nmur2 A C 11: 55,931,308 (GRCm39) I134M probably benign Het
Nrp2 A C 1: 62,784,670 (GRCm39) E273A probably benign Het
Nup85 A G 11: 115,468,787 (GRCm39) D210G possibly damaging Het
Obscn A G 11: 59,006,643 (GRCm39) F1173S probably damaging Het
Or5ac24 A T 16: 59,165,145 (GRCm39) C306* probably null Het
Otogl T A 10: 107,652,974 (GRCm39) E1126V probably null Het
Pfkl T C 10: 77,833,426 (GRCm39) I259V probably benign Het
Phkg1 A T 5: 129,893,863 (GRCm39) Y291N probably benign Het
Piezo2 T G 18: 63,163,450 (GRCm39) H2156P probably damaging Het
Piezo2 C A 18: 63,208,790 (GRCm39) V1408L probably damaging Het
Pira13 T A 7: 3,819,997 (GRCm39) E640V unknown Het
Pkd2 A G 5: 104,626,959 (GRCm39) probably null Het
Plekhg3 A G 12: 76,622,694 (GRCm39) T646A probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ppp1r12a T C 10: 108,098,224 (GRCm39) S838P probably damaging Het
Rarb A T 14: 16,435,235 (GRCm38) Y270* probably null Het
Rbm15 T C 3: 107,239,312 (GRCm39) E362G possibly damaging Het
Rcan1 A G 16: 92,262,741 (GRCm39) F76L Het
Rdh19 T C 10: 127,696,142 (GRCm39) L298P probably damaging Het
Rims1 T A 1: 22,498,773 (GRCm39) H57L Het
Rlf T C 4: 121,004,751 (GRCm39) T1520A probably benign Het
Rnase1 T A 14: 51,382,964 (GRCm39) H130L possibly damaging Het
Samd8 T A 14: 21,842,569 (GRCm39) M360K probably damaging Het
Samhd1 A G 2: 156,956,205 (GRCm39) L329P probably damaging Het
Scube1 C T 15: 83,494,394 (GRCm39) E878K probably damaging Het
Sema3b T C 9: 107,476,154 (GRCm39) Y689C probably damaging Het
Semp2l2a T C 8: 13,886,697 (GRCm39) T465A possibly damaging Het
Sgo1 T C 17: 53,983,931 (GRCm39) probably benign Het
Sh3pxd2b A T 11: 32,373,361 (GRCm39) N843Y possibly damaging Het
Slco1a6 C T 6: 142,035,575 (GRCm39) C583Y probably damaging Het
Smg1 A C 7: 117,811,786 (GRCm39) V88G unknown Het
Spata24 T A 18: 35,790,054 (GRCm39) N146Y probably damaging Het
Tcf3 C A 10: 80,253,191 (GRCm39) V258L probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tiam2 T C 17: 3,465,011 (GRCm39) Y247H probably damaging Het
Ticrr T C 7: 79,310,604 (GRCm39) F173L possibly damaging Het
Tpp2 A G 1: 43,993,811 (GRCm39) E232G probably damaging Het
Trank1 T A 9: 111,174,547 (GRCm39) V138E probably damaging Het
Ttll3 T C 6: 113,369,596 (GRCm39) S47P probably benign Het
Utp4 C T 8: 107,632,857 (GRCm39) T280M probably damaging Het
Vmn1r123 A T 7: 20,896,794 (GRCm39) N229Y probably benign Het
Vmn1r85 A T 7: 12,818,942 (GRCm39) Y67* probably null Het
Zbtb12 T A 17: 35,114,320 (GRCm39) V35E possibly damaging Het
Zmym6 T A 4: 127,017,854 (GRCm39) F1212I probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTCGCATGTGGAGAAG -3'
(R):5'- ATCAGAGTGTCACTGGAATTCCC -3'

Sequencing Primer
(F):5'- GAGAAGATGTACCAGTTCTCCCTG -3'
(R):5'- ACTGGAATTCCCTCTCATGATGGTG -3'
Posted On 2022-03-25