Incidental Mutation 'R9271:Ticrr'
ID 702926
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R9271 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79310604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 173 (F173L)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: F173L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: F173L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000206017
AA Change: F173L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: F173L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206622
AA Change: F173L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,901,940 (GRCm39) S819T probably damaging Het
Abca13 A T 11: 9,241,698 (GRCm39) D1187V probably damaging Het
Ak9 C A 10: 41,300,623 (GRCm39) T1611K unknown Het
Als2 G T 1: 59,242,189 (GRCm39) T622K probably benign Het
Ankrd40 G A 11: 94,225,262 (GRCm39) A98T probably benign Het
Ap1b1 T C 11: 4,973,174 (GRCm39) L339P probably damaging Het
Appl1 A C 14: 26,669,084 (GRCm39) H363Q probably benign Het
Atf6 T C 1: 170,622,245 (GRCm39) N459D probably damaging Het
Ccdc6 A T 10: 70,024,993 (GRCm39) Q432L unknown Het
Ccl21a T A 4: 42,773,486 (GRCm39) Q84L probably damaging Het
Cct4 A G 11: 22,951,389 (GRCm39) I348V probably benign Het
Cd300ld2 A G 11: 114,904,550 (GRCm39) Y106H probably damaging Het
Cdh19 C T 1: 110,876,947 (GRCm39) E131K probably damaging Het
Cdon A G 9: 35,403,175 (GRCm39) D1095G probably damaging Het
Cep85l T A 10: 53,157,670 (GRCm39) R678* probably null Het
Chst3 T A 10: 60,021,465 (GRCm39) S461C probably damaging Het
Clk1 A G 1: 58,459,312 (GRCm39) I149T possibly damaging Het
Clvs2 T A 10: 33,389,301 (GRCm39) D313V possibly damaging Het
Dap3 T C 3: 88,840,913 (GRCm39) T75A probably benign Het
Dnaaf1 T A 8: 120,324,392 (GRCm39) F631L probably benign Het
Dnah14 A T 1: 181,597,325 (GRCm39) N3549I probably benign Het
Dnah17 A T 11: 117,931,870 (GRCm39) Y3701N probably damaging Het
Dock6 A G 9: 21,752,796 (GRCm39) V339A possibly damaging Het
Dpp6 T A 5: 27,803,832 (GRCm39) C259* probably null Het
Dqx1 A G 6: 83,036,024 (GRCm39) T119A probably benign Het
Dync1h1 G T 12: 110,583,310 (GRCm39) R469L probably benign Het
Eno4 C T 19: 58,951,260 (GRCm39) A424V probably benign Het
Entrep1 A T 19: 23,972,221 (GRCm39) I161N possibly damaging Het
Fads1 T A 19: 10,163,162 (GRCm39) D146E probably damaging Het
Fam171a1 C T 2: 3,224,543 (GRCm39) T303M probably damaging Het
Fbxw20 C T 9: 109,050,423 (GRCm39) D401N probably benign Het
Fcho1 T A 8: 72,163,068 (GRCm39) T654S possibly damaging Het
Flad1 C A 3: 89,315,858 (GRCm39) E235* probably null Het
Flrt2 G T 12: 95,745,907 (GRCm39) A82S probably benign Het
Gabrg3 A T 7: 56,829,386 (GRCm39) S124T probably benign Het
Galt C T 4: 41,756,777 (GRCm39) T139I probably benign Het
Garin4 A G 1: 190,895,153 (GRCm39) S497P probably damaging Het
Gfod1 T C 13: 43,456,861 (GRCm39) E38G possibly damaging Het
Gm10330 A G 12: 23,829,992 (GRCm39) I63T possibly damaging Het
Gm3033 A T 14: 3,846,968 (GRCm38) N28I Het
Gm49359 A G 13: 62,602,867 (GRCm39) V111A probably benign Het
Gpank1 C T 17: 35,340,734 (GRCm39) probably benign Het
Hck T C 2: 152,973,185 (GRCm39) L156P probably damaging Het
Hcn3 G T 3: 89,057,267 (GRCm39) R444S probably damaging Het
Hephl1 T C 9: 14,988,236 (GRCm39) N624S probably damaging Het
Hmcn1 A G 1: 150,632,309 (GRCm39) I876T probably damaging Het
Itga9 T A 9: 118,500,859 (GRCm39) D377E possibly damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Itprid1 G T 6: 55,944,051 (GRCm39) R417L probably benign Het
Kcnk1 T A 8: 126,752,152 (GRCm39) probably null Het
Klk1b11 C T 7: 43,425,954 (GRCm39) L32F probably benign Het
Lta4h A G 10: 93,310,412 (GRCm39) S427G probably benign Het
Lxn T A 3: 67,368,651 (GRCm39) I122F probably damaging Het
Lyz1 A G 10: 117,124,492 (GRCm39) V148A possibly damaging Het
Mael G T 1: 166,032,424 (GRCm39) Q326K probably benign Het
Magi3 T C 3: 103,923,264 (GRCm39) D1151G possibly damaging Het
Map3k9 C A 12: 81,769,261 (GRCm39) G929V probably benign Het
Mcoln1 A G 8: 3,555,771 (GRCm39) Y22C probably damaging Het
Mier3 G T 13: 111,827,870 (GRCm39) M45I probably benign Het
Mrpl1 T C 5: 96,371,746 (GRCm39) V91A probably damaging Het
Msra T C 14: 64,471,269 (GRCm39) probably null Het
Myo7a T C 7: 97,740,281 (GRCm39) H571R probably benign Het
Myom1 T A 17: 71,374,325 (GRCm39) W601R probably damaging Het
Myom3 C T 4: 135,505,479 (GRCm39) T456I probably benign Het
Nags A T 11: 102,037,584 (GRCm39) H225L probably benign Het
Ncaph C A 2: 126,958,554 (GRCm39) K488N probably damaging Het
Nkain3 C T 4: 20,484,897 (GRCm39) R60H probably damaging Het
Nlrp9a A T 7: 26,261,944 (GRCm39) M698L probably benign Het
Nmur2 A C 11: 55,931,308 (GRCm39) I134M probably benign Het
Nrp2 A C 1: 62,784,670 (GRCm39) E273A probably benign Het
Nup85 A G 11: 115,468,787 (GRCm39) D210G possibly damaging Het
Obscn A G 11: 59,006,643 (GRCm39) F1173S probably damaging Het
Or5ac24 A T 16: 59,165,145 (GRCm39) C306* probably null Het
Otogl T A 10: 107,652,974 (GRCm39) E1126V probably null Het
Pfkl T C 10: 77,833,426 (GRCm39) I259V probably benign Het
Phkg1 A T 5: 129,893,863 (GRCm39) Y291N probably benign Het
Piezo2 T G 18: 63,163,450 (GRCm39) H2156P probably damaging Het
Piezo2 C A 18: 63,208,790 (GRCm39) V1408L probably damaging Het
Pira13 T A 7: 3,819,997 (GRCm39) E640V unknown Het
Pkd2 A G 5: 104,626,959 (GRCm39) probably null Het
Plekhg3 A G 12: 76,622,694 (GRCm39) T646A probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Ppp1r12a T C 10: 108,098,224 (GRCm39) S838P probably damaging Het
Rarb A T 14: 16,435,235 (GRCm38) Y270* probably null Het
Rbm15 T C 3: 107,239,312 (GRCm39) E362G possibly damaging Het
Rcan1 A G 16: 92,262,741 (GRCm39) F76L Het
Rdh19 T C 10: 127,696,142 (GRCm39) L298P probably damaging Het
Rims1 T A 1: 22,498,773 (GRCm39) H57L Het
Rlf T C 4: 121,004,751 (GRCm39) T1520A probably benign Het
Rnase1 T A 14: 51,382,964 (GRCm39) H130L possibly damaging Het
Samd8 T A 14: 21,842,569 (GRCm39) M360K probably damaging Het
Samhd1 A G 2: 156,956,205 (GRCm39) L329P probably damaging Het
Scube1 C T 15: 83,494,394 (GRCm39) E878K probably damaging Het
Sema3b T C 9: 107,476,154 (GRCm39) Y689C probably damaging Het
Semp2l2a T C 8: 13,886,697 (GRCm39) T465A possibly damaging Het
Sgo1 T C 17: 53,983,931 (GRCm39) probably benign Het
Sh3pxd2b A T 11: 32,373,361 (GRCm39) N843Y possibly damaging Het
Slco1a6 C T 6: 142,035,575 (GRCm39) C583Y probably damaging Het
Smg1 A C 7: 117,811,786 (GRCm39) V88G unknown Het
Spata24 T A 18: 35,790,054 (GRCm39) N146Y probably damaging Het
Tcf3 C A 10: 80,253,191 (GRCm39) V258L probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tiam2 T C 17: 3,465,011 (GRCm39) Y247H probably damaging Het
Tpp2 A G 1: 43,993,811 (GRCm39) E232G probably damaging Het
Trank1 T A 9: 111,174,547 (GRCm39) V138E probably damaging Het
Ttll3 T C 6: 113,369,596 (GRCm39) S47P probably benign Het
Utp4 C T 8: 107,632,857 (GRCm39) T280M probably damaging Het
Vmn1r123 A T 7: 20,896,794 (GRCm39) N229Y probably benign Het
Vmn1r85 A T 7: 12,818,942 (GRCm39) Y67* probably null Het
Zbtb12 T A 17: 35,114,320 (GRCm39) V35E possibly damaging Het
Zmym6 T A 4: 127,017,854 (GRCm39) F1212I probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAAGTTCTTCGACTCTCAGGGG -3'
(R):5'- GATCCAGACTGCTTCTCACC -3'

Sequencing Primer
(F):5'- ATGGAGACGCTGCTCGACTAC -3'
(R):5'- CTTACCTTAGATCGCTCGGTGG -3'
Posted On 2022-03-25