Incidental Mutation 'R9271:AF366264'
ID 702930
Institutional Source Beutler Lab
Gene Symbol AF366264
Ensembl Gene ENSMUSG00000057116
Gene Name cDNA sequence AF366264
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock # R9271 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13835233-13838389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13836697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 465 (T465A)
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
AlphaFold G3X9P9
Predicted Effect possibly damaging
Transcript: ENSMUST00000071308
AA Change: T465A

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116
AA Change: T465A

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,114 S819T probably damaging Het
Abca13 A T 11: 9,291,698 D1187V probably damaging Het
Ak9 C A 10: 41,424,627 T1611K unknown Het
Als2 G T 1: 59,203,030 T622K probably benign Het
Ankrd40 G A 11: 94,334,436 A98T probably benign Het
Ap1b1 T C 11: 5,023,174 L339P probably damaging Het
Appl1 A C 14: 26,947,127 H363Q probably benign Het
Atf6 T C 1: 170,794,676 N459D probably damaging Het
Ccdc129 G T 6: 55,967,066 R417L probably benign Het
Ccdc6 A T 10: 70,189,163 Q432L unknown Het
Ccl21a T A 4: 42,773,486 Q84L probably damaging Het
Cct4 A G 11: 23,001,389 I348V probably benign Het
Cd300ld2 A G 11: 115,013,724 Y106H probably damaging Het
Cdh19 C T 1: 110,949,217 E131K probably damaging Het
Cdon A G 9: 35,491,879 D1095G probably damaging Het
Cep85l T A 10: 53,281,574 R678* probably null Het
Chst3 T A 10: 60,185,643 S461C probably damaging Het
Clk1 A G 1: 58,420,153 I149T possibly damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Dap3 T C 3: 88,933,606 T75A probably benign Het
Dnaaf1 T A 8: 119,597,653 F631L probably benign Het
Dnah14 A T 1: 181,769,760 N3549I probably benign Het
Dnah17 A T 11: 118,041,044 Y3701N probably damaging Het
Dock6 A G 9: 21,841,500 V339A possibly damaging Het
Dpp6 T A 5: 27,598,834 C259* probably null Het
Dqx1 A G 6: 83,059,043 T119A probably benign Het
Dync1h1 G T 12: 110,616,876 R469L probably benign Het
Eno4 C T 19: 58,962,828 A424V probably benign Het
Fads1 T A 19: 10,185,798 D146E probably damaging Het
Fam171a1 C T 2: 3,223,506 T303M probably damaging Het
Fam189a2 A T 19: 23,994,857 I161N possibly damaging Het
Fam71a A G 1: 191,162,956 S497P probably damaging Het
Fbxw20 C T 9: 109,221,355 D401N probably benign Het
Fcho1 T A 8: 71,710,424 T654S possibly damaging Het
Flad1 C A 3: 89,408,551 E235* probably null Het
Flrt2 G T 12: 95,779,133 A82S probably benign Het
Gabrg3 A T 7: 57,179,638 S124T probably benign Het
Galt C T 4: 41,756,777 T139I probably benign Het
Gfod1 T C 13: 43,303,385 E38G possibly damaging Het
Gm10330 A G 12: 23,779,991 I63T possibly damaging Het
Gm15448 T A 7: 3,816,998 E640V unknown Het
Gm3033 A T 14: 3,846,968 N28I Het
Gm49359 A G 13: 62,455,053 V111A probably benign Het
Gpank1 C T 17: 35,121,758 probably benign Het
Hck T C 2: 153,131,265 L156P probably damaging Het
Hcn3 G T 3: 89,149,960 R444S probably damaging Het
Hephl1 T C 9: 15,076,940 N624S probably damaging Het
Hmcn1 A G 1: 150,756,558 I876T probably damaging Het
Itga9 T A 9: 118,671,791 D377E possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klk11 C T 7: 43,776,530 L32F probably benign Het
Lta4h A G 10: 93,474,550 S427G probably benign Het
Lxn T A 3: 67,461,318 I122F probably damaging Het
Lyz1 A G 10: 117,288,587 V148A possibly damaging Het
Mael G T 1: 166,204,855 Q326K probably benign Het
Magi3 T C 3: 104,015,948 D1151G possibly damaging Het
Map3k9 C A 12: 81,722,487 G929V probably benign Het
Mcoln1 A G 8: 3,505,771 Y22C probably damaging Het
Mier3 G T 13: 111,691,336 M45I probably benign Het
Mrpl1 T C 5: 96,223,887 V91A probably damaging Het
Myo7a T C 7: 98,091,074 H571R probably benign Het
Myom1 T A 17: 71,067,330 W601R probably damaging Het
Myom3 C T 4: 135,778,168 T456I probably benign Het
Nags A T 11: 102,146,758 H225L probably benign Het
Ncaph C A 2: 127,116,634 K488N probably damaging Het
Nkain3 C T 4: 20,484,897 R60H probably damaging Het
Nlrp9a A T 7: 26,562,519 M698L probably benign Het
Nmur2 A C 11: 56,040,482 I134M probably benign Het
Nrp2 A C 1: 62,745,511 E273A probably benign Het
Nup85 A G 11: 115,577,961 D210G possibly damaging Het
Obscn A G 11: 59,115,817 F1173S probably damaging Het
Olfr206 A T 16: 59,344,782 C306* probably null Het
Otogl T A 10: 107,817,113 E1126V probably null Het
Pfkl T C 10: 77,997,592 I259V probably benign Het
Phkg1 A T 5: 129,865,022 Y291N probably benign Het
Piezo2 T G 18: 63,030,379 H2156P probably damaging Het
Piezo2 C A 18: 63,075,719 V1408L probably damaging Het
Plekhg3 A G 12: 76,575,920 T646A probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1r12a T C 10: 108,262,363 S838P probably damaging Het
Rarb A T 14: 16,435,235 Y270* probably null Het
Rbm15 T C 3: 107,331,996 E362G possibly damaging Het
Rcan1 A G 16: 92,465,853 F76L Het
Rdh19 T C 10: 127,860,273 L298P probably damaging Het
Rims1 T A 1: 22,428,522 H57L Het
Rlf T C 4: 121,147,554 T1520A probably benign Het
Rnase1 T A 14: 51,145,507 H130L possibly damaging Het
Samd8 T A 14: 21,792,501 M360K probably damaging Het
Samhd1 A G 2: 157,114,285 L329P probably damaging Het
Scube1 C T 15: 83,610,193 E878K probably damaging Het
Sema3b T C 9: 107,598,955 Y689C probably damaging Het
Sh3pxd2b A T 11: 32,423,361 N843Y possibly damaging Het
Slco1a6 C T 6: 142,089,849 C583Y probably damaging Het
Smg1 A C 7: 118,212,563 V88G unknown Het
Spata24 T A 18: 35,657,001 N146Y probably damaging Het
Tcf3 C A 10: 80,417,357 V258L probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tiam2 T C 17: 3,414,736 Y247H probably damaging Het
Ticrr T C 7: 79,660,856 F173L possibly damaging Het
Tpp2 A G 1: 43,954,651 E232G probably damaging Het
Trank1 T A 9: 111,345,479 V138E probably damaging Het
Ttll3 T C 6: 113,392,635 S47P probably benign Het
Utp4 C T 8: 106,906,225 T280M probably damaging Het
Vmn1r123 A T 7: 21,162,869 N229Y probably benign Het
Vmn1r85 A T 7: 13,085,015 Y67* probably null Het
Zbtb12 T A 17: 34,895,344 V35E possibly damaging Het
Zmym6 T A 4: 127,124,061 F1212I probably damaging Het
Other mutations in AF366264
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:AF366264 APN 8 13837704 missense probably benign 0.03
IGL02647:AF366264 APN 8 13836979 missense probably damaging 0.96
IGL03118:AF366264 APN 8 13838096 utr 5 prime probably benign
FR4342:AF366264 UTSW 8 13837613 missense probably benign 0.00
R0636:AF366264 UTSW 8 13837870 missense probably benign 0.00
R1796:AF366264 UTSW 8 13836816 nonsense probably null
R1913:AF366264 UTSW 8 13837143 missense probably benign 0.16
R2353:AF366264 UTSW 8 13836951 missense probably damaging 1.00
R2944:AF366264 UTSW 8 13837212 missense probably damaging 1.00
R3714:AF366264 UTSW 8 13836736 missense probably benign 0.04
R4222:AF366264 UTSW 8 13838061 missense probably benign
R4628:AF366264 UTSW 8 13836625 missense probably damaging 1.00
R4801:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4802:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4836:AF366264 UTSW 8 13838007 missense probably benign
R5143:AF366264 UTSW 8 13836844 missense possibly damaging 0.87
R5637:AF366264 UTSW 8 13837713 missense possibly damaging 0.46
R5930:AF366264 UTSW 8 13837263 missense probably benign 0.06
R6540:AF366264 UTSW 8 13837573 missense probably benign 0.07
R6556:AF366264 UTSW 8 13837690 nonsense probably null
R6724:AF366264 UTSW 8 13837083 missense probably damaging 1.00
R7131:AF366264 UTSW 8 13836982 missense probably damaging 0.98
R7148:AF366264 UTSW 8 13837996 missense probably benign 0.01
R7660:AF366264 UTSW 8 13837995 missense probably benign 0.06
R8198:AF366264 UTSW 8 13837056 missense probably benign 0.11
R8483:AF366264 UTSW 8 13838229 start gained probably benign
R9090:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
X0020:AF366264 UTSW 8 13836847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTCATCCAGTGAGACAGC -3'
(R):5'- TTGTATACCTCGATTCCATGGG -3'

Sequencing Primer
(F):5'- CCTACCTGAGGTATATTAGAAACAGG -3'
(R):5'- GACAGACAGGGAAGTCTATCTGTG -3'
Posted On 2022-03-25