Incidental Mutation 'R9271:Hephl1'
ID 702935
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Name hephaestin-like 1
Synonyms LOC244698, zyklopen, Zp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9271 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 15051841-15112108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15076940 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 624 (N624S)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
AlphaFold Q3V1H3
Predicted Effect probably damaging
Transcript: ENSMUST00000159985
AA Change: N624S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: N624S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,114 S819T probably damaging Het
Abca13 A T 11: 9,291,698 D1187V probably damaging Het
AF366264 T C 8: 13,836,697 T465A possibly damaging Het
Ak9 C A 10: 41,424,627 T1611K unknown Het
Als2 G T 1: 59,203,030 T622K probably benign Het
Ankrd40 G A 11: 94,334,436 A98T probably benign Het
Ap1b1 T C 11: 5,023,174 L339P probably damaging Het
Appl1 A C 14: 26,947,127 H363Q probably benign Het
Atf6 T C 1: 170,794,676 N459D probably damaging Het
Ccdc129 G T 6: 55,967,066 R417L probably benign Het
Ccdc6 A T 10: 70,189,163 Q432L unknown Het
Ccl21a T A 4: 42,773,486 Q84L probably damaging Het
Cct4 A G 11: 23,001,389 I348V probably benign Het
Cd300ld2 A G 11: 115,013,724 Y106H probably damaging Het
Cdh19 C T 1: 110,949,217 E131K probably damaging Het
Cdon A G 9: 35,491,879 D1095G probably damaging Het
Cep85l T A 10: 53,281,574 R678* probably null Het
Chst3 T A 10: 60,185,643 S461C probably damaging Het
Clk1 A G 1: 58,420,153 I149T possibly damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Dap3 T C 3: 88,933,606 T75A probably benign Het
Dnaaf1 T A 8: 119,597,653 F631L probably benign Het
Dnah14 A T 1: 181,769,760 N3549I probably benign Het
Dnah17 A T 11: 118,041,044 Y3701N probably damaging Het
Dock6 A G 9: 21,841,500 V339A possibly damaging Het
Dpp6 T A 5: 27,598,834 C259* probably null Het
Dqx1 A G 6: 83,059,043 T119A probably benign Het
Dync1h1 G T 12: 110,616,876 R469L probably benign Het
Eno4 C T 19: 58,962,828 A424V probably benign Het
Fads1 T A 19: 10,185,798 D146E probably damaging Het
Fam171a1 C T 2: 3,223,506 T303M probably damaging Het
Fam189a2 A T 19: 23,994,857 I161N possibly damaging Het
Fam71a A G 1: 191,162,956 S497P probably damaging Het
Fbxw20 C T 9: 109,221,355 D401N probably benign Het
Fcho1 T A 8: 71,710,424 T654S possibly damaging Het
Flad1 C A 3: 89,408,551 E235* probably null Het
Flrt2 G T 12: 95,779,133 A82S probably benign Het
Gabrg3 A T 7: 57,179,638 S124T probably benign Het
Galt C T 4: 41,756,777 T139I probably benign Het
Gfod1 T C 13: 43,303,385 E38G possibly damaging Het
Gm10330 A G 12: 23,779,991 I63T possibly damaging Het
Gm15448 T A 7: 3,816,998 E640V unknown Het
Gm3033 A T 14: 3,846,968 N28I Het
Gm49359 A G 13: 62,455,053 V111A probably benign Het
Gpank1 C T 17: 35,121,758 probably benign Het
Hck T C 2: 153,131,265 L156P probably damaging Het
Hcn3 G T 3: 89,149,960 R444S probably damaging Het
Hmcn1 A G 1: 150,756,558 I876T probably damaging Het
Itga9 T A 9: 118,671,791 D377E possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klk11 C T 7: 43,776,530 L32F probably benign Het
Lta4h A G 10: 93,474,550 S427G probably benign Het
Lxn T A 3: 67,461,318 I122F probably damaging Het
Lyz1 A G 10: 117,288,587 V148A possibly damaging Het
Mael G T 1: 166,204,855 Q326K probably benign Het
Magi3 T C 3: 104,015,948 D1151G possibly damaging Het
Map3k9 C A 12: 81,722,487 G929V probably benign Het
Mcoln1 A G 8: 3,505,771 Y22C probably damaging Het
Mier3 G T 13: 111,691,336 M45I probably benign Het
Mrpl1 T C 5: 96,223,887 V91A probably damaging Het
Myo7a T C 7: 98,091,074 H571R probably benign Het
Myom1 T A 17: 71,067,330 W601R probably damaging Het
Myom3 C T 4: 135,778,168 T456I probably benign Het
Nags A T 11: 102,146,758 H225L probably benign Het
Ncaph C A 2: 127,116,634 K488N probably damaging Het
Nkain3 C T 4: 20,484,897 R60H probably damaging Het
Nlrp9a A T 7: 26,562,519 M698L probably benign Het
Nmur2 A C 11: 56,040,482 I134M probably benign Het
Nrp2 A C 1: 62,745,511 E273A probably benign Het
Nup85 A G 11: 115,577,961 D210G possibly damaging Het
Obscn A G 11: 59,115,817 F1173S probably damaging Het
Olfr206 A T 16: 59,344,782 C306* probably null Het
Otogl T A 10: 107,817,113 E1126V probably null Het
Pfkl T C 10: 77,997,592 I259V probably benign Het
Phkg1 A T 5: 129,865,022 Y291N probably benign Het
Piezo2 T G 18: 63,030,379 H2156P probably damaging Het
Piezo2 C A 18: 63,075,719 V1408L probably damaging Het
Plekhg3 A G 12: 76,575,920 T646A probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1r12a T C 10: 108,262,363 S838P probably damaging Het
Rarb A T 14: 16,435,235 Y270* probably null Het
Rbm15 T C 3: 107,331,996 E362G possibly damaging Het
Rcan1 A G 16: 92,465,853 F76L Het
Rdh19 T C 10: 127,860,273 L298P probably damaging Het
Rims1 T A 1: 22,428,522 H57L Het
Rlf T C 4: 121,147,554 T1520A probably benign Het
Rnase1 T A 14: 51,145,507 H130L possibly damaging Het
Samd8 T A 14: 21,792,501 M360K probably damaging Het
Samhd1 A G 2: 157,114,285 L329P probably damaging Het
Scube1 C T 15: 83,610,193 E878K probably damaging Het
Sema3b T C 9: 107,598,955 Y689C probably damaging Het
Sh3pxd2b A T 11: 32,423,361 N843Y possibly damaging Het
Slco1a6 C T 6: 142,089,849 C583Y probably damaging Het
Smg1 A C 7: 118,212,563 V88G unknown Het
Spata24 T A 18: 35,657,001 N146Y probably damaging Het
Tcf3 C A 10: 80,417,357 V258L probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tiam2 T C 17: 3,414,736 Y247H probably damaging Het
Ticrr T C 7: 79,660,856 F173L possibly damaging Het
Tpp2 A G 1: 43,954,651 E232G probably damaging Het
Trank1 T A 9: 111,345,479 V138E probably damaging Het
Ttll3 T C 6: 113,392,635 S47P probably benign Het
Utp4 C T 8: 106,906,225 T280M probably damaging Het
Vmn1r123 A T 7: 21,162,869 N229Y probably benign Het
Vmn1r85 A T 7: 13,085,015 Y67* probably null Het
Zbtb12 T A 17: 34,895,344 V35E possibly damaging Het
Zmym6 T A 4: 127,124,061 F1212I probably damaging Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1833:Hephl1 UTSW 9 15076928 missense probably damaging 0.99
R1908:Hephl1 UTSW 9 15074124 nonsense probably null
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R1986:Hephl1 UTSW 9 15054552 missense probably damaging 1.00
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6653:Hephl1 UTSW 9 15081964 missense probably damaging 0.99
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
R7715:Hephl1 UTSW 9 15060785 missense probably benign 0.36
R8013:Hephl1 UTSW 9 15054609 missense possibly damaging 0.78
R8156:Hephl1 UTSW 9 15060914 missense possibly damaging 0.77
R8755:Hephl1 UTSW 9 15074267 missense probably benign
R8755:Hephl1 UTSW 9 15111984 missense probably damaging 1.00
R8777:Hephl1 UTSW 9 15060794 missense probably benign 0.24
R8777-TAIL:Hephl1 UTSW 9 15060794 missense probably benign 0.24
R9090:Hephl1 UTSW 9 15076940 missense probably damaging 1.00
R9155:Hephl1 UTSW 9 15089079 missense probably damaging 1.00
R9287:Hephl1 UTSW 9 15084479 missense probably benign 0.01
R9487:Hephl1 UTSW 9 15084534 missense possibly damaging 0.84
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Z1177:Hephl1 UTSW 9 15090054 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGGTCTGGCTGCATG -3'
(R):5'- TTAGTTCTAGCCACCTTGTAGC -3'

Sequencing Primer
(F):5'- CGTTGTGGCCATATGGGGAAAC -3'
(R):5'- AGCCACCTTGTAGCATTTTCTCTAG -3'
Posted On 2022-03-25