Mutagenetix > Incidental Mutation

Incidental Mutation 'R0750:Btrc'

70294

Institutional Source

Beutler Lab

Gene Symbol

Btrc

Ensembl Gene

ENSMUSG00000025217

Gene Name

beta-transducin repeat containing protein

Synonyms

Beta-Trcp1, Fbw1a, SCF b-TRCP, beta-TrCP, Slimb

MMRRC Submission

038930-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0750 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45352173-45518452 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 45491585 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Cysteine at position 81 (F81C)

Ref Sequence

ENSEMBL: ENSMUSP00000153562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065601] [ENSMUST00000111936] [ENSMUST00000223684] [ENSMUST00000223764] [ENSMUST00000224478]

AlphaFold

Q3ULA2

Predicted Effect

probably damaging
Transcript: ENSMUST00000065601
AA Change: F180C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070728
Gene: ENSMUSG00000025217
AA Change: F180C

Domain	Start	End	E-Value	Type
Beta-TrCP_D	138	177	3.32e-25	SMART
FBOX	189	228	5.83e-6	SMART
WD40	292	329	7.92e-3	SMART
WD40	332	369	8.68e-9	SMART
WD40	372	409	5.31e-4	SMART
WD40	415	452	5.18e-7	SMART
WD40	455	492	3.93e-7	SMART
WD40	495	532	8.42e-7	SMART
WD40	544	581	4.62e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111936
AA Change: F144C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107567
Gene: ENSMUSG00000025217
AA Change: F144C

Domain	Start	End	E-Value	Type
Beta-TrCP_D	102	141	3.32e-25	SMART
FBOX	153	192	5.83e-6	SMART
WD40	256	293	7.92e-3	SMART
WD40	296	333	8.68e-9	SMART
WD40	336	373	5.31e-4	SMART
WD40	379	416	5.18e-7	SMART
WD40	419	456	3.93e-7	SMART
WD40	459	496	8.42e-7	SMART
WD40	508	545	4.62e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223684

Predicted Effect

probably damaging
Transcript: ENSMUST00000223764
AA Change: F88C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224478
AA Change: F81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225662

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. The encoded protein mediates degradation of CD4 via its interaction with HIV-1 Vpu. It has also been shown to ubiquitinate phosphorylated NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), targeting it for degradation and thus activating nuclear factor kappa-B. Alternatively spliced transcript variants have been described. A related pseudogene exists in chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Embryonic fibroblasts from homozygotes show an increase in polyploidy and apoptosis and decreased cell proliferation. In a second allele, homozygous mutation results in reduced male fertility and abnormal male meiosis with oligozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agrn	A	T	4: 156,251,394 (GRCm39)	L1974*	probably null	Het
Brd4	T	C	17: 32,439,226 (GRCm39)	E418G	probably benign	Het
Brip1	G	A	11: 85,952,325 (GRCm39)	S1152L	possibly damaging	Het
Cep85l	A	G	10: 53,157,642 (GRCm39)	L585P	probably damaging	Het
Cfap46	T	G	7: 139,234,586 (GRCm39)	E671D	probably damaging	Het
Dsg1a	T	C	18: 20,473,210 (GRCm39)	L761P	probably benign	Het
Ece2	G	T	16: 20,451,800 (GRCm39)	V396L	probably benign	Het
Garin4	G	A	1: 190,896,682 (GRCm39)		probably benign	Het
Hs6st3	CGGAGGAGGAGGAGGAGGA	CGGAGGAGGAGGAGGA	14: 119,376,119 (GRCm39)		probably benign	Het
Id2	A	G	12: 25,145,670 (GRCm39)	S114P	probably damaging	Het
Igf1r	T	C	7: 67,861,839 (GRCm39)	F1133S	probably damaging	Het
Izumo1	T	C	7: 45,275,707 (GRCm39)		probably null	Het
Krt35	A	G	11: 99,986,979 (GRCm39)	S12P	possibly damaging	Het
Or5a1	T	C	19: 12,098,077 (GRCm39)		probably null	Het
Pkdrej	G	T	15: 85,702,275 (GRCm39)	D1220E	probably benign	Het
Pramel32	A	G	4: 88,545,905 (GRCm39)	F479S	probably benign	Het
Sema3a	G	A	5: 13,607,092 (GRCm39)		probably null	Het
Tmed6	T	C	8: 107,788,401 (GRCm39)	Y182C	possibly damaging	Het
Tmem174	G	T	13: 98,773,787 (GRCm39)	N14K	probably damaging	Het
Tmem87b	T	C	2: 128,660,356 (GRCm39)	L33P	possibly damaging	Het
Vmn1r16	T	C	6: 57,299,812 (GRCm39)	Y270C	probably benign	Het
Vps37d	A	T	5: 135,103,294 (GRCm39)	L116Q	possibly damaging	Het
Zfp592	A	G	7: 80,674,493 (GRCm39)	S486G	probably benign	Het

Other mutations in Btrc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Btrc	APN	19	45,515,704 (GRCm39)	missense	probably damaging	0.99
IGL01691:Btrc	APN	19	45,501,117 (GRCm39)	missense	probably benign	0.00
IGL02551:Btrc	APN	19	45,411,573 (GRCm39)	missense	possibly damaging	0.83
IGL02719:Btrc	APN	19	45,491,589 (GRCm39)	missense	probably damaging	1.00
IGL02852:Btrc	APN	19	45,501,095 (GRCm39)	nonsense	probably null
IGL03128:Btrc	APN	19	45,501,959 (GRCm39)	missense	probably damaging	1.00
IGL03267:Btrc	APN	19	45,507,262 (GRCm39)	missense	probably damaging	1.00
R0145:Btrc	UTSW	19	45,411,612 (GRCm39)	missense	probably damaging	0.97
R1466:Btrc	UTSW	19	45,501,821 (GRCm39)	splice site	probably benign
R1584:Btrc	UTSW	19	45,501,821 (GRCm39)	splice site	probably benign
R1772:Btrc	UTSW	19	45,501,100 (GRCm39)	missense	probably damaging	0.98
R1882:Btrc	UTSW	19	45,515,839 (GRCm39)	missense	probably damaging	1.00
R1959:Btrc	UTSW	19	45,515,782 (GRCm39)	missense	probably damaging	1.00
R1961:Btrc	UTSW	19	45,515,782 (GRCm39)	missense	probably damaging	1.00
R2483:Btrc	UTSW	19	45,504,497 (GRCm39)	missense	probably damaging	1.00
R4365:Btrc	UTSW	19	45,501,919 (GRCm39)	missense	probably damaging	1.00
R4812:Btrc	UTSW	19	45,411,603 (GRCm39)	missense	possibly damaging	0.83
R4883:Btrc	UTSW	19	45,445,026 (GRCm39)	missense	probably benign	0.09
R5321:Btrc	UTSW	19	45,496,197 (GRCm39)	missense	probably damaging	1.00
R7203:Btrc	UTSW	19	45,501,967 (GRCm39)	splice site	probably null
R7528:Btrc	UTSW	19	45,491,525 (GRCm39)	missense	possibly damaging	0.95
R8737:Btrc	UTSW	19	45,496,198 (GRCm39)	missense	probably damaging	1.00
R9603:Btrc	UTSW	19	45,459,526 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGCCAAACTTGCCAATGGCAC -3'
(R):5'- AGCACGTTCAATGCTGAGACAGAAG -3'

Sequencing Primer
(F):5'- ATGGCACTTCCAGCATGATTG -3'
(R):5'- ctgagacagaagactgctgag -3'

Posted On

2013-09-30