Incidental Mutation 'R9271:Myom1'
ID 702987
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9271 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71067330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 601 (W601R)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: W601R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: W601R

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: W601R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: W601R

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: W601R

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: W601R

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,114 S819T probably damaging Het
Abca13 A T 11: 9,291,698 D1187V probably damaging Het
AF366264 T C 8: 13,836,697 T465A possibly damaging Het
Ak9 C A 10: 41,424,627 T1611K unknown Het
Als2 G T 1: 59,203,030 T622K probably benign Het
Ankrd40 G A 11: 94,334,436 A98T probably benign Het
Ap1b1 T C 11: 5,023,174 L339P probably damaging Het
Appl1 A C 14: 26,947,127 H363Q probably benign Het
Atf6 T C 1: 170,794,676 N459D probably damaging Het
Ccdc129 G T 6: 55,967,066 R417L probably benign Het
Ccdc6 A T 10: 70,189,163 Q432L unknown Het
Ccl21a T A 4: 42,773,486 Q84L probably damaging Het
Cct4 A G 11: 23,001,389 I348V probably benign Het
Cd300ld2 A G 11: 115,013,724 Y106H probably damaging Het
Cdh19 C T 1: 110,949,217 E131K probably damaging Het
Cdon A G 9: 35,491,879 D1095G probably damaging Het
Cep85l T A 10: 53,281,574 R678* probably null Het
Chst3 T A 10: 60,185,643 S461C probably damaging Het
Clk1 A G 1: 58,420,153 I149T possibly damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Dap3 T C 3: 88,933,606 T75A probably benign Het
Dnaaf1 T A 8: 119,597,653 F631L probably benign Het
Dnah14 A T 1: 181,769,760 N3549I probably benign Het
Dnah17 A T 11: 118,041,044 Y3701N probably damaging Het
Dock6 A G 9: 21,841,500 V339A possibly damaging Het
Dpp6 T A 5: 27,598,834 C259* probably null Het
Dqx1 A G 6: 83,059,043 T119A probably benign Het
Dync1h1 G T 12: 110,616,876 R469L probably benign Het
Eno4 C T 19: 58,962,828 A424V probably benign Het
Fads1 T A 19: 10,185,798 D146E probably damaging Het
Fam171a1 C T 2: 3,223,506 T303M probably damaging Het
Fam189a2 A T 19: 23,994,857 I161N possibly damaging Het
Fam71a A G 1: 191,162,956 S497P probably damaging Het
Fbxw20 C T 9: 109,221,355 D401N probably benign Het
Fcho1 T A 8: 71,710,424 T654S possibly damaging Het
Flad1 C A 3: 89,408,551 E235* probably null Het
Flrt2 G T 12: 95,779,133 A82S probably benign Het
Gabrg3 A T 7: 57,179,638 S124T probably benign Het
Galt C T 4: 41,756,777 T139I probably benign Het
Gfod1 T C 13: 43,303,385 E38G possibly damaging Het
Gm10330 A G 12: 23,779,991 I63T possibly damaging Het
Gm15448 T A 7: 3,816,998 E640V unknown Het
Gm3033 A T 14: 3,846,968 N28I Het
Gm49359 A G 13: 62,455,053 V111A probably benign Het
Gpank1 C T 17: 35,121,758 probably benign Het
Hck T C 2: 153,131,265 L156P probably damaging Het
Hcn3 G T 3: 89,149,960 R444S probably damaging Het
Hephl1 T C 9: 15,076,940 N624S probably damaging Het
Hmcn1 A G 1: 150,756,558 I876T probably damaging Het
Itga9 T A 9: 118,671,791 D377E possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klk11 C T 7: 43,776,530 L32F probably benign Het
Lta4h A G 10: 93,474,550 S427G probably benign Het
Lxn T A 3: 67,461,318 I122F probably damaging Het
Lyz1 A G 10: 117,288,587 V148A possibly damaging Het
Mael G T 1: 166,204,855 Q326K probably benign Het
Magi3 T C 3: 104,015,948 D1151G possibly damaging Het
Map3k9 C A 12: 81,722,487 G929V probably benign Het
Mcoln1 A G 8: 3,505,771 Y22C probably damaging Het
Mier3 G T 13: 111,691,336 M45I probably benign Het
Mrpl1 T C 5: 96,223,887 V91A probably damaging Het
Myo7a T C 7: 98,091,074 H571R probably benign Het
Myom3 C T 4: 135,778,168 T456I probably benign Het
Nags A T 11: 102,146,758 H225L probably benign Het
Ncaph C A 2: 127,116,634 K488N probably damaging Het
Nkain3 C T 4: 20,484,897 R60H probably damaging Het
Nlrp9a A T 7: 26,562,519 M698L probably benign Het
Nmur2 A C 11: 56,040,482 I134M probably benign Het
Nrp2 A C 1: 62,745,511 E273A probably benign Het
Nup85 A G 11: 115,577,961 D210G possibly damaging Het
Obscn A G 11: 59,115,817 F1173S probably damaging Het
Olfr206 A T 16: 59,344,782 C306* probably null Het
Otogl T A 10: 107,817,113 E1126V probably null Het
Pfkl T C 10: 77,997,592 I259V probably benign Het
Phkg1 A T 5: 129,865,022 Y291N probably benign Het
Piezo2 T G 18: 63,030,379 H2156P probably damaging Het
Piezo2 C A 18: 63,075,719 V1408L probably damaging Het
Plekhg3 A G 12: 76,575,920 T646A probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1r12a T C 10: 108,262,363 S838P probably damaging Het
Rarb A T 14: 16,435,235 Y270* probably null Het
Rbm15 T C 3: 107,331,996 E362G possibly damaging Het
Rcan1 A G 16: 92,465,853 F76L Het
Rdh19 T C 10: 127,860,273 L298P probably damaging Het
Rims1 T A 1: 22,428,522 H57L Het
Rlf T C 4: 121,147,554 T1520A probably benign Het
Rnase1 T A 14: 51,145,507 H130L possibly damaging Het
Samd8 T A 14: 21,792,501 M360K probably damaging Het
Samhd1 A G 2: 157,114,285 L329P probably damaging Het
Scube1 C T 15: 83,610,193 E878K probably damaging Het
Sema3b T C 9: 107,598,955 Y689C probably damaging Het
Sh3pxd2b A T 11: 32,423,361 N843Y possibly damaging Het
Slco1a6 C T 6: 142,089,849 C583Y probably damaging Het
Smg1 A C 7: 118,212,563 V88G unknown Het
Spata24 T A 18: 35,657,001 N146Y probably damaging Het
Tcf3 C A 10: 80,417,357 V258L probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tiam2 T C 17: 3,414,736 Y247H probably damaging Het
Ticrr T C 7: 79,660,856 F173L possibly damaging Het
Tpp2 A G 1: 43,954,651 E232G probably damaging Het
Trank1 T A 9: 111,345,479 V138E probably damaging Het
Ttll3 T C 6: 113,392,635 S47P probably benign Het
Utp4 C T 8: 106,906,225 T280M probably damaging Het
Vmn1r123 A T 7: 21,162,869 N229Y probably benign Het
Vmn1r85 A T 7: 13,085,015 Y67* probably null Het
Zbtb12 T A 17: 34,895,344 V35E possibly damaging Het
Zmym6 T A 4: 127,124,061 F1212I probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
R8554:Myom1 UTSW 17 71036453 missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71106204 missense probably damaging 1.00
R8981:Myom1 UTSW 17 71084321 missense probably benign 0.09
R9012:Myom1 UTSW 17 71100108 missense probably benign 0.06
R9090:Myom1 UTSW 17 71067330 missense probably damaging 1.00
R9193:Myom1 UTSW 17 71036300 missense probably damaging 1.00
R9237:Myom1 UTSW 17 71101056 missense probably damaging 1.00
R9355:Myom1 UTSW 17 71077893 missense probably damaging 1.00
R9362:Myom1 UTSW 17 71036293 missense probably benign 0.00
R9440:Myom1 UTSW 17 71126334 missense probably benign 0.00
R9469:Myom1 UTSW 17 71061127 missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71087481 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCCAGAAACTGTCAGGGAGG -3'
(R):5'- GAAGTATGTCCTTGGCCTGTCC -3'

Sequencing Primer
(F):5'- AGGGGTATGCTTCACCCAGTAC -3'
(R):5'- TGTCCATGGCCCTGGGTTC -3'
Posted On 2022-03-25