Mutagenetix > Incidental Mutation

Incidental Mutation 'R9271:Piezo2'

702990

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9271 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 63075719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1408 (V1408L)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: V1408L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: V1408L

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182233

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183217
AA Change: V1394L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: V1394L

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (107/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	T	11: 120,011,114	S819T	probably damaging	Het
Abca13	A	T	11: 9,291,698	D1187V	probably damaging	Het
AF366264	T	C	8: 13,836,697	T465A	possibly damaging	Het
Ak9	C	A	10: 41,424,627	T1611K	unknown	Het
Als2	G	T	1: 59,203,030	T622K	probably benign	Het
Ankrd40	G	A	11: 94,334,436	A98T	probably benign	Het
Ap1b1	T	C	11: 5,023,174	L339P	probably damaging	Het
Appl1	A	C	14: 26,947,127	H363Q	probably benign	Het
Atf6	T	C	1: 170,794,676	N459D	probably damaging	Het
Ccdc129	G	T	6: 55,967,066	R417L	probably benign	Het
Ccdc6	A	T	10: 70,189,163	Q432L	unknown	Het
Ccl21a	T	A	4: 42,773,486	Q84L	probably damaging	Het
Cct4	A	G	11: 23,001,389	I348V	probably benign	Het
Cd300ld2	A	G	11: 115,013,724	Y106H	probably damaging	Het
Cdh19	C	T	1: 110,949,217	E131K	probably damaging	Het
Cdon	A	G	9: 35,491,879	D1095G	probably damaging	Het
Cep85l	T	A	10: 53,281,574	R678*	probably null	Het
Chst3	T	A	10: 60,185,643	S461C	probably damaging	Het
Clk1	A	G	1: 58,420,153	I149T	possibly damaging	Het
Clvs2	T	A	10: 33,513,305	D313V	possibly damaging	Het
Dap3	T	C	3: 88,933,606	T75A	probably benign	Het
Dnaaf1	T	A	8: 119,597,653	F631L	probably benign	Het
Dnah14	A	T	1: 181,769,760	N3549I	probably benign	Het
Dnah17	A	T	11: 118,041,044	Y3701N	probably damaging	Het
Dock6	A	G	9: 21,841,500	V339A	possibly damaging	Het
Dpp6	T	A	5: 27,598,834	C259*	probably null	Het
Dqx1	A	G	6: 83,059,043	T119A	probably benign	Het
Dync1h1	G	T	12: 110,616,876	R469L	probably benign	Het
Eno4	C	T	19: 58,962,828	A424V	probably benign	Het
Fads1	T	A	19: 10,185,798	D146E	probably damaging	Het
Fam171a1	C	T	2: 3,223,506	T303M	probably damaging	Het
Fam189a2	A	T	19: 23,994,857	I161N	possibly damaging	Het
Fam71a	A	G	1: 191,162,956	S497P	probably damaging	Het
Fbxw20	C	T	9: 109,221,355	D401N	probably benign	Het
Fcho1	T	A	8: 71,710,424	T654S	possibly damaging	Het
Flad1	C	A	3: 89,408,551	E235*	probably null	Het
Flrt2	G	T	12: 95,779,133	A82S	probably benign	Het
Gabrg3	A	T	7: 57,179,638	S124T	probably benign	Het
Galt	C	T	4: 41,756,777	T139I	probably benign	Het
Gfod1	T	C	13: 43,303,385	E38G	possibly damaging	Het
Gm10330	A	G	12: 23,779,991	I63T	possibly damaging	Het
Gm15448	T	A	7: 3,816,998	E640V	unknown	Het
Gm3033	A	T	14: 3,846,968	N28I		Het
Gm49359	A	G	13: 62,455,053	V111A	probably benign	Het
Gpank1	C	T	17: 35,121,758		probably benign	Het
Hck	T	C	2: 153,131,265	L156P	probably damaging	Het
Hcn3	G	T	3: 89,149,960	R444S	probably damaging	Het
Hephl1	T	C	9: 15,076,940	N624S	probably damaging	Het
Hmcn1	A	G	1: 150,756,558	I876T	probably damaging	Het
Itga9	T	A	9: 118,671,791	D377E	possibly damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnk1	T	A	8: 126,025,413		probably null	Het
Klk11	C	T	7: 43,776,530	L32F	probably benign	Het
Lta4h	A	G	10: 93,474,550	S427G	probably benign	Het
Lxn	T	A	3: 67,461,318	I122F	probably damaging	Het
Lyz1	A	G	10: 117,288,587	V148A	possibly damaging	Het
Mael	G	T	1: 166,204,855	Q326K	probably benign	Het
Magi3	T	C	3: 104,015,948	D1151G	possibly damaging	Het
Map3k9	C	A	12: 81,722,487	G929V	probably benign	Het
Mcoln1	A	G	8: 3,505,771	Y22C	probably damaging	Het
Mier3	G	T	13: 111,691,336	M45I	probably benign	Het
Mrpl1	T	C	5: 96,223,887	V91A	probably damaging	Het
Msra	T	C	14: 64,233,820		probably null	Het
Myo7a	T	C	7: 98,091,074	H571R	probably benign	Het
Myom1	T	A	17: 71,067,330	W601R	probably damaging	Het
Myom3	C	T	4: 135,778,168	T456I	probably benign	Het
Nags	A	T	11: 102,146,758	H225L	probably benign	Het
Ncaph	C	A	2: 127,116,634	K488N	probably damaging	Het
Nkain3	C	T	4: 20,484,897	R60H	probably damaging	Het
Nlrp9a	A	T	7: 26,562,519	M698L	probably benign	Het
Nmur2	A	C	11: 56,040,482	I134M	probably benign	Het
Nrp2	A	C	1: 62,745,511	E273A	probably benign	Het
Nup85	A	G	11: 115,577,961	D210G	possibly damaging	Het
Obscn	A	G	11: 59,115,817	F1173S	probably damaging	Het
Olfr206	A	T	16: 59,344,782	C306*	probably null	Het
Otogl	T	A	10: 107,817,113	E1126V	probably null	Het
Pfkl	T	C	10: 77,997,592	I259V	probably benign	Het
Phkg1	A	T	5: 129,865,022	Y291N	probably benign	Het
Pkd2	A	G	5: 104,479,093		probably null	Het
Plekhg3	A	G	12: 76,575,920	T646A	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ppp1r12a	T	C	10: 108,262,363	S838P	probably damaging	Het
Rarb	A	T	14: 16,435,235	Y270*	probably null	Het
Rbm15	T	C	3: 107,331,996	E362G	possibly damaging	Het
Rcan1	A	G	16: 92,465,853	F76L		Het
Rdh19	T	C	10: 127,860,273	L298P	probably damaging	Het
Rims1	T	A	1: 22,428,522	H57L		Het
Rlf	T	C	4: 121,147,554	T1520A	probably benign	Het
Rnase1	T	A	14: 51,145,507	H130L	possibly damaging	Het
Samd8	T	A	14: 21,792,501	M360K	probably damaging	Het
Samhd1	A	G	2: 157,114,285	L329P	probably damaging	Het
Scube1	C	T	15: 83,610,193	E878K	probably damaging	Het
Sema3b	T	C	9: 107,598,955	Y689C	probably damaging	Het
Sgo1	T	C	17: 53,676,903		probably benign	Het
Sh3pxd2b	A	T	11: 32,423,361	N843Y	possibly damaging	Het
Slco1a6	C	T	6: 142,089,849	C583Y	probably damaging	Het
Smg1	A	C	7: 118,212,563	V88G	unknown	Het
Spata24	T	A	18: 35,657,001	N146Y	probably damaging	Het
Tcf3	C	A	10: 80,417,357	V258L	probably benign	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tiam2	T	C	17: 3,414,736	Y247H	probably damaging	Het
Ticrr	T	C	7: 79,660,856	F173L	possibly damaging	Het
Tpp2	A	G	1: 43,954,651	E232G	probably damaging	Het
Trank1	T	A	9: 111,345,479	V138E	probably damaging	Het
Ttll3	T	C	6: 113,392,635	S47P	probably benign	Het
Utp4	C	T	8: 106,906,225	T280M	probably damaging	Het
Vmn1r123	A	T	7: 21,162,869	N229Y	probably benign	Het
Vmn1r85	A	T	7: 13,085,015	Y67*	probably null	Het
Zbtb12	T	A	17: 34,895,344	V35E	possibly damaging	Het
Zmym6	T	A	4: 127,124,061	F1212I	probably damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTGATAGGCAATGGTTCATCAC -3'
(R):5'- TTTTAGATACTGCAGGGCCCTC -3'

Sequencing Primer
(F):5'- GGCAATGGTTCATCACATAGTGC -3'
(R):5'- CCCTCTGGAATTGTTGGCATCG -3'

Posted On

2022-03-25