Incidental Mutation 'R9272:Ighv5-9-1'
ID 703038
Institutional Source Beutler Lab
Gene Symbol Ighv5-9-1
Ensembl Gene ENSMUSG00000095210
Gene Name immunoglobulin heavy variable 5-9-1
Synonyms Gm16886
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R9272 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113736111-113736630 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113736198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 98 (I98N)
Ref Sequence ENSEMBL: ENSMUSP00000141243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103452] [ENSMUST00000192264]
AlphaFold A0A075B5Q6
Predicted Effect probably damaging
Transcript: ENSMUST00000103452
AA Change: I88N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100233
Gene: ENSMUSG00000095210
AA Change: I88N

DomainStartEndE-ValueType
IGv 35 116 8.34e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192264
AA Change: I98N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141243
Gene: ENSMUSG00000095210
AA Change: I98N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGv 45 126 3.3e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A G 6: 146,953,001 V181A probably damaging Het
9330182L06Rik T C 5: 9,410,699 Y207H probably damaging Het
Abca16 T A 7: 120,477,770 D686E probably benign Het
Abca8a C A 11: 110,063,082 C844F probably damaging Het
Acd G A 8: 105,698,320 P396L probably damaging Het
Adamtsl3 A G 7: 82,540,545 Y659C probably damaging Het
Ankfn1 C T 11: 89,523,049 V167M probably benign Het
Ankrd13c T A 3: 157,994,721 L393Q possibly damaging Het
Arid1b G A 17: 5,336,604 G1391D possibly damaging Het
Arid5b T A 10: 68,102,052 D415V probably damaging Het
Arl13b G T 16: 62,827,411 H45N probably benign Het
Atp13a4 A T 16: 29,449,979 I519N Het
Atrnl1 T C 19: 57,654,988 I436T probably benign Het
Bbx A G 16: 50,202,572 I675T probably damaging Het
Bcas1 A T 2: 170,348,120 V619E probably damaging Het
Cad T C 5: 31,061,232 V501A possibly damaging Het
Car8 T A 4: 8,169,686 N274I probably damaging Het
Ccdc3 A G 2: 5,141,332 Q159R probably damaging Het
Ccdc7b A T 8: 129,166,978 E95D possibly damaging Het
Cdh12 G T 15: 21,492,715 probably benign Het
Col11a1 G T 3: 114,108,299 G548* probably null Het
Cpb2 A G 14: 75,283,363 E406G probably damaging Het
Crocc T C 4: 141,019,821 S1723G probably benign Het
Ctu2 T C 8: 122,479,306 V262A probably benign Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dock3 A T 9: 106,897,370 M62K probably benign Het
Dok7 G A 5: 35,056,895 probably benign Het
E2f3 A G 13: 29,918,646 Y211H probably damaging Het
Fam129c A C 8: 71,602,876 D310A probably damaging Het
Fam53c T A 18: 34,762,721 S25R probably damaging Het
Fhod3 T G 18: 24,897,624 probably benign Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Ggt1 A T 10: 75,585,915 H532L probably benign Het
Gm10775 A C 13: 65,259,956 T24P unknown Het
Hinfp A G 9: 44,302,575 S2P probably benign Het
Hs3st4 A G 7: 123,983,526 T116A probably benign Het
Ipo11 A T 13: 106,910,205 Y171N probably benign Het
Jph1 C A 1: 17,091,614 A275S probably damaging Het
Kcnh6 C G 11: 106,034,034 H941Q possibly damaging Het
Kcnh7 A T 2: 62,787,753 I464K probably damaging Het
Lrp8 C A 4: 107,859,961 P603T probably benign Het
Man1c1 C A 4: 134,563,807 D593Y probably damaging Het
Mdm4 A T 1: 133,001,431 I176K possibly damaging Het
Mpo T C 11: 87,795,867 V139A probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1015 A T 2: 85,785,744 I78L probably benign Het
Olfr1301 G A 2: 111,754,620 V124M probably damaging Het
Olfr1366 A G 13: 21,537,694 S89P possibly damaging Het
Park2 T A 17: 11,237,640 V117E probably damaging Het
Pcdh7 A G 5: 57,721,437 D778G possibly damaging Het
Pcdhb12 T C 18: 37,437,622 F607S probably damaging Het
Pcolce A G 5: 137,608,071 F157L probably benign Het
Pogk T C 1: 166,399,211 Y457C probably damaging Het
Ppp1r21 G A 17: 88,558,658 E323K possibly damaging Het
Prr12 A C 7: 45,043,387 F1574V probably damaging Het
Rasl2-9 A T 7: 5,125,449 F161I probably damaging Het
Rb1 A G 14: 73,280,162 I268T possibly damaging Het
Rin3 A T 12: 102,369,432 D534V probably damaging Het
Scn5a C T 9: 119,486,651 G1664S probably damaging Het
Sin3b T C 8: 72,744,540 S372P probably benign Het
Snx32 T A 19: 5,498,457 H65L probably damaging Het
Spidr T A 16: 16,037,680 I324F probably damaging Het
Stab1 A T 14: 31,145,341 F1687L probably benign Het
Taar6 T C 10: 23,985,005 I214M probably benign Het
Vmn2r105 T A 17: 20,227,423 N380Y probably damaging Het
Other mutations in Ighv5-9-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ighv5-9-1 APN 12 113736390 missense probably damaging 1.00
R4921:Ighv5-9-1 UTSW 12 113736294 missense possibly damaging 0.61
R5161:Ighv5-9-1 UTSW 12 113736157 missense possibly damaging 0.70
R5559:Ighv5-9-1 UTSW 12 113736125 nonsense probably null
R5678:Ighv5-9-1 UTSW 12 113736587 missense possibly damaging 0.72
R7529:Ighv5-9-1 UTSW 12 113736334 missense possibly damaging 0.91
R7618:Ighv5-9-1 UTSW 12 113736199 missense probably damaging 0.99
R7791:Ighv5-9-1 UTSW 12 113736545 missense probably damaging 0.99
R9331:Ighv5-9-1 UTSW 12 113736258 missense possibly damaging 0.80
Z1088:Ighv5-9-1 UTSW 12 113736120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCAGAACTCCATATGCTCTC -3'
(R):5'- TGTCCAGTGTGACGTGAAGC -3'

Sequencing Primer
(F):5'- AGAACTCCATATGCTCTCTGCGC -3'
(R):5'- ACGTGAAGCTGGTGGAGTC -3'
Posted On 2022-03-25