Incidental Mutation 'R9273:Cfap65'
ID 703061
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock # R9273 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74921610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 734 (M734L)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: M734L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: M734L

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,149,029 D728G probably benign Het
Adig A C 2: 158,507,970 *57S probably null Het
Adig A T 2: 158,505,807 D48V probably damaging Het
Amigo3 A G 9: 108,054,821 D481G probably damaging Het
Atf6b T A 17: 34,653,994 M628K probably damaging Het
Atoh8 A G 6: 72,235,145 L7P probably damaging Het
Bcl9 A G 3: 97,208,643 S912P probably damaging Het
Card9 T A 2: 26,357,298 I280F probably damaging Het
Ccr9 A G 9: 123,780,020 T256A probably benign Het
Cd300lg T C 11: 102,048,764 I306T probably damaging Het
Cobll1 A G 2: 65,099,012 S657P probably damaging Het
Comp A G 8: 70,378,635 N384S probably damaging Het
Cps1 T A 1: 67,152,286 V209D possibly damaging Het
Cwc22 A T 2: 77,929,459 D81E possibly damaging Het
D630045J12Rik G A 6: 38,190,577 P1030L possibly damaging Het
Dcn A G 10: 97,507,775 Y199C probably damaging Het
Exosc3 A T 4: 45,316,969 I228N probably damaging Het
Fbxo10 T C 4: 45,062,178 H116R probably benign Het
Fbxo21 T A 5: 118,008,043 I577N probably damaging Het
Flnc A T 6: 29,447,816 Q1206L probably benign Het
Fubp3 T C 2: 31,613,044 F480L probably benign Het
Fzd5 T C 1: 64,735,951 N217S possibly damaging Het
Garem1 G A 18: 21,148,217 R361C probably damaging Het
Gcg T C 2: 62,475,789 M155V probably null Het
Gm7298 G A 6: 121,779,645 probably benign Het
Gpr160 T A 3: 30,895,889 L37I probably benign Het
Grik1 G A 16: 88,051,491 H130Y Het
Hydin T A 8: 110,506,948 I1806N probably damaging Het
Isl1 A T 13: 116,308,366 C42* probably null Het
Itpr2 T C 6: 146,325,031 D1405G probably damaging Het
Kat6b A G 14: 21,661,483 N682D probably benign Het
Kcnh6 C G 11: 106,034,034 H941Q possibly damaging Het
Kprp A C 3: 92,825,693 C17G probably damaging Het
Lsm14a T C 7: 34,388,800 probably benign Het
Mrgpra2a G T 7: 47,426,559 T317K probably benign Het
Myh11 A G 16: 14,236,419 V360A Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Oaf G A 9: 43,222,669 P252S probably benign Het
Obox2 T G 7: 15,397,365 V132G unknown Het
Olfr1448 T C 19: 12,920,082 T76A possibly damaging Het
Olfr1463 C T 19: 13,234,904 S218L probably damaging Het
Olfr624 T A 7: 103,670,426 T202S probably benign Het
Olfr690 A G 7: 105,329,439 L251P probably damaging Het
Pld2 T A 11: 70,557,408 S894T probably benign Het
Plxna1 G T 6: 89,319,382 S1893R possibly damaging Het
Prkd1 T C 12: 50,425,449 E227G possibly damaging Het
Prox1 T C 1: 190,161,045 N401S possibly damaging Het
Prune2 T C 19: 17,118,326 V398A possibly damaging Het
Rasgef1a A G 6: 118,086,262 N285D probably benign Het
Rbbp5 A G 1: 132,492,566 K179R probably benign Het
Rp9 G A 9: 22,468,277 probably benign Het
Slc15a2 A G 16: 36,753,728 F588L probably benign Het
Sptan1 T A 2: 29,990,965 D415E possibly damaging Het
Syne1 T C 10: 5,040,901 K593E probably benign Het
Tab1 A G 15: 80,157,703 T341A probably benign Het
Tmc4 T C 7: 3,667,553 E513G probably damaging Het
Tmem131l A C 3: 83,940,937 V302G probably damaging Het
Tnip1 G A 11: 54,916,957 H553Y possibly damaging Het
Tns2 C T 15: 102,113,043 P1048S probably damaging Het
Twsg1 C T 17: 65,926,311 V215I probably damaging Het
Txnl1 G A 18: 63,692,254 probably benign Het
Unc13c A G 9: 73,932,580 Y330H possibly damaging Het
Utrn A T 10: 12,633,963 W2422R probably damaging Het
Vmn2r112 T A 17: 22,618,740 D727E probably damaging Het
Vmn2r59 G T 7: 42,045,862 C375* probably null Het
Vopp1 G T 6: 57,754,590 Q139K possibly damaging Het
Vwa5b1 T C 4: 138,588,694 D579G probably damaging Het
Wdr6 A G 9: 108,573,492 Y971H probably benign Het
Zfp354c A G 11: 50,815,232 F339L probably damaging Het
Zfyve26 A G 12: 79,270,836 probably null Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGGCCCAGTTCCTCTACC -3'
(R):5'- ATGCAGAGATCTTGGCTCTC -3'

Sequencing Primer
(F):5'- TACCCCTGCCTCCTACCTTGAG -3'
(R):5'- TCCTTGGAGACAGCATCATC -3'
Posted On 2022-03-25