Incidental Mutation 'R9273:Cfap65'
ID 703061
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R9273 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74960769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 734 (M734L)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: M734L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: M734L

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,033,232 (GRCm39) D728G probably benign Het
Adig A T 2: 158,347,727 (GRCm39) D48V probably damaging Het
Adig A C 2: 158,349,890 (GRCm39) *57S probably null Het
Amigo3 A G 9: 107,932,020 (GRCm39) D481G probably damaging Het
Atf6b T A 17: 34,872,968 (GRCm39) M628K probably damaging Het
Atoh8 A G 6: 72,212,129 (GRCm39) L7P probably damaging Het
Bcl9 A G 3: 97,115,959 (GRCm39) S912P probably damaging Het
Card9 T A 2: 26,247,310 (GRCm39) I280F probably damaging Het
Ccr9 A G 9: 123,609,085 (GRCm39) T256A probably benign Het
Cd300lg T C 11: 101,939,590 (GRCm39) I306T probably damaging Het
Cobll1 A G 2: 64,929,356 (GRCm39) S657P probably damaging Het
Comp A G 8: 70,831,285 (GRCm39) N384S probably damaging Het
Cps1 T A 1: 67,191,445 (GRCm39) V209D possibly damaging Het
Cwc22 A T 2: 77,759,803 (GRCm39) D81E possibly damaging Het
D630045J12Rik G A 6: 38,167,512 (GRCm39) P1030L possibly damaging Het
Dcn A G 10: 97,343,637 (GRCm39) Y199C probably damaging Het
Exosc3 A T 4: 45,316,969 (GRCm39) I228N probably damaging Het
Fbxo10 T C 4: 45,062,178 (GRCm39) H116R probably benign Het
Fbxo21 T A 5: 118,146,108 (GRCm39) I577N probably damaging Het
Flnc A T 6: 29,447,815 (GRCm39) Q1206L probably benign Het
Fubp3 T C 2: 31,503,056 (GRCm39) F480L probably benign Het
Fzd5 T C 1: 64,775,110 (GRCm39) N217S possibly damaging Het
Garem1 G A 18: 21,281,274 (GRCm39) R361C probably damaging Het
Gcg T C 2: 62,306,133 (GRCm39) M155V probably null Het
Gm7298 G A 6: 121,756,604 (GRCm39) probably benign Het
Gpr160 T A 3: 30,950,038 (GRCm39) L37I probably benign Het
Grik1 G A 16: 87,848,379 (GRCm39) H130Y Het
Hydin T A 8: 111,233,580 (GRCm39) I1806N probably damaging Het
Isl1 A T 13: 116,444,902 (GRCm39) C42* probably null Het
Itpr2 T C 6: 146,226,529 (GRCm39) D1405G probably damaging Het
Kat6b A G 14: 21,711,551 (GRCm39) N682D probably benign Het
Kcnh6 C G 11: 105,924,860 (GRCm39) H941Q possibly damaging Het
Kprp A C 3: 92,733,000 (GRCm39) C17G probably damaging Het
Lsm14a T C 7: 34,088,225 (GRCm39) probably benign Het
Mrgpra2a G T 7: 47,076,307 (GRCm39) T317K probably benign Het
Myh11 A G 16: 14,054,283 (GRCm39) V360A Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Oaf G A 9: 43,133,966 (GRCm39) P252S probably benign Het
Obox2 T G 7: 15,131,290 (GRCm39) V132G unknown Het
Or51v8 T A 7: 103,319,633 (GRCm39) T202S probably benign Het
Or52b1 A G 7: 104,978,646 (GRCm39) L251P probably damaging Het
Or5b109 C T 19: 13,212,268 (GRCm39) S218L probably damaging Het
Or5b12 T C 19: 12,897,446 (GRCm39) T76A possibly damaging Het
Pld2 T A 11: 70,448,234 (GRCm39) S894T probably benign Het
Plxna1 G T 6: 89,296,364 (GRCm39) S1893R possibly damaging Het
Prkd1 T C 12: 50,472,232 (GRCm39) E227G possibly damaging Het
Prox1 T C 1: 189,893,242 (GRCm39) N401S possibly damaging Het
Prune2 T C 19: 17,095,690 (GRCm39) V398A possibly damaging Het
Rasgef1a A G 6: 118,063,223 (GRCm39) N285D probably benign Het
Rbbp5 A G 1: 132,420,304 (GRCm39) K179R probably benign Het
Rp9 G A 9: 22,379,573 (GRCm39) probably benign Het
Slc15a2 A G 16: 36,574,090 (GRCm39) F588L probably benign Het
Sptan1 T A 2: 29,880,977 (GRCm39) D415E possibly damaging Het
Syne1 T C 10: 4,990,901 (GRCm39) K593E probably benign Het
Tab1 A G 15: 80,041,904 (GRCm39) T341A probably benign Het
Tmc4 T C 7: 3,670,552 (GRCm39) E513G probably damaging Het
Tmem131l A C 3: 83,848,244 (GRCm39) V302G probably damaging Het
Tnip1 G A 11: 54,807,783 (GRCm39) H553Y possibly damaging Het
Tns2 C T 15: 102,021,478 (GRCm39) P1048S probably damaging Het
Twsg1 C T 17: 66,233,306 (GRCm39) V215I probably damaging Het
Txnl1 G A 18: 63,825,325 (GRCm39) probably benign Het
Unc13c A G 9: 73,839,862 (GRCm39) Y330H possibly damaging Het
Utrn A T 10: 12,509,707 (GRCm39) W2422R probably damaging Het
Vmn2r112 T A 17: 22,837,721 (GRCm39) D727E probably damaging Het
Vmn2r59 G T 7: 41,695,286 (GRCm39) C375* probably null Het
Vopp1 G T 6: 57,731,575 (GRCm39) Q139K possibly damaging Het
Vwa5b1 T C 4: 138,316,005 (GRCm39) D579G probably damaging Het
Wdr6 A G 9: 108,450,691 (GRCm39) Y971H probably benign Het
Zfp354c A G 11: 50,706,059 (GRCm39) F339L probably damaging Het
Zfyve26 A G 12: 79,317,610 (GRCm39) probably null Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGGCCCAGTTCCTCTACC -3'
(R):5'- ATGCAGAGATCTTGGCTCTC -3'

Sequencing Primer
(F):5'- TACCCCTGCCTCCTACCTTGAG -3'
(R):5'- TCCTTGGAGACAGCATCATC -3'
Posted On 2022-03-25