Incidental Mutation 'R9273:Prune2'
ID 703128
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_181348
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9273 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 16956118-17223932 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17118326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 398 (V398A)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087689
AA Change: V398A

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: V398A

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,149,029 D728G probably benign Het
Adig A T 2: 158,505,807 D48V probably damaging Het
Adig A C 2: 158,507,970 *57S probably null Het
Amigo3 A G 9: 108,054,821 D481G probably damaging Het
Atf6b T A 17: 34,653,994 M628K probably damaging Het
Atoh8 A G 6: 72,235,145 L7P probably damaging Het
Bcl9 A G 3: 97,208,643 S912P probably damaging Het
Card9 T A 2: 26,357,298 I280F probably damaging Het
Ccr9 A G 9: 123,780,020 T256A probably benign Het
Cd300lg T C 11: 102,048,764 I306T probably damaging Het
Cfap65 T A 1: 74,921,610 M734L probably benign Het
Cobll1 A G 2: 65,099,012 S657P probably damaging Het
Comp A G 8: 70,378,635 N384S probably damaging Het
Cps1 T A 1: 67,152,286 V209D possibly damaging Het
Cwc22 A T 2: 77,929,459 D81E possibly damaging Het
D630045J12Rik G A 6: 38,190,577 P1030L possibly damaging Het
Dcn A G 10: 97,507,775 Y199C probably damaging Het
Exosc3 A T 4: 45,316,969 I228N probably damaging Het
Fbxo10 T C 4: 45,062,178 H116R probably benign Het
Fbxo21 T A 5: 118,008,043 I577N probably damaging Het
Flnc A T 6: 29,447,816 Q1206L probably benign Het
Fubp3 T C 2: 31,613,044 F480L probably benign Het
Fzd5 T C 1: 64,735,951 N217S possibly damaging Het
Garem1 G A 18: 21,148,217 R361C probably damaging Het
Gcg T C 2: 62,475,789 M155V probably null Het
Gm7298 G A 6: 121,779,645 probably benign Het
Gpr160 T A 3: 30,895,889 L37I probably benign Het
Grik1 G A 16: 88,051,491 H130Y Het
Hydin T A 8: 110,506,948 I1806N probably damaging Het
Isl1 A T 13: 116,308,366 C42* probably null Het
Itpr2 T C 6: 146,325,031 D1405G probably damaging Het
Kat6b A G 14: 21,661,483 N682D probably benign Het
Kcnh6 C G 11: 106,034,034 H941Q possibly damaging Het
Kprp A C 3: 92,825,693 C17G probably damaging Het
Lsm14a T C 7: 34,388,800 probably benign Het
Mrgpra2a G T 7: 47,426,559 T317K probably benign Het
Myh11 A G 16: 14,236,419 V360A Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Oaf G A 9: 43,222,669 P252S probably benign Het
Obox2 T G 7: 15,397,365 V132G unknown Het
Olfr1448 T C 19: 12,920,082 T76A possibly damaging Het
Olfr1463 C T 19: 13,234,904 S218L probably damaging Het
Olfr624 T A 7: 103,670,426 T202S probably benign Het
Olfr690 A G 7: 105,329,439 L251P probably damaging Het
Pld2 T A 11: 70,557,408 S894T probably benign Het
Plxna1 G T 6: 89,319,382 S1893R possibly damaging Het
Prkd1 T C 12: 50,425,449 E227G possibly damaging Het
Prox1 T C 1: 190,161,045 N401S possibly damaging Het
Rasgef1a A G 6: 118,086,262 N285D probably benign Het
Rbbp5 A G 1: 132,492,566 K179R probably benign Het
Rp9 G A 9: 22,468,277 probably benign Het
Slc15a2 A G 16: 36,753,728 F588L probably benign Het
Sptan1 T A 2: 29,990,965 D415E possibly damaging Het
Syne1 T C 10: 5,040,901 K593E probably benign Het
Tab1 A G 15: 80,157,703 T341A probably benign Het
Tmc4 T C 7: 3,667,553 E513G probably damaging Het
Tmem131l A C 3: 83,940,937 V302G probably damaging Het
Tnip1 G A 11: 54,916,957 H553Y possibly damaging Het
Tns2 C T 15: 102,113,043 P1048S probably damaging Het
Twsg1 C T 17: 65,926,311 V215I probably damaging Het
Txnl1 G A 18: 63,692,254 probably benign Het
Unc13c A G 9: 73,932,580 Y330H possibly damaging Het
Utrn A T 10: 12,633,963 W2422R probably damaging Het
Vmn2r112 T A 17: 22,618,740 D727E probably damaging Het
Vmn2r59 G T 7: 42,045,862 C375* probably null Het
Vopp1 G T 6: 57,754,590 Q139K possibly damaging Het
Vwa5b1 T C 4: 138,588,694 D579G probably damaging Het
Wdr6 A G 9: 108,573,492 Y971H probably benign Het
Zfp354c A G 11: 50,815,232 F339L probably damaging Het
Zfyve26 A G 12: 79,270,836 probably null Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense probably benign 0.39
R7102:Prune2 UTSW 19 17121213 missense probably benign 0.24
R7246:Prune2 UTSW 19 17121368 missense probably damaging 0.99
R7284:Prune2 UTSW 19 17119886 missense probably damaging 1.00
R7295:Prune2 UTSW 19 17119897 missense probably benign 0.01
R7371:Prune2 UTSW 19 17119370 missense probably benign 0.02
R7651:Prune2 UTSW 19 17120408 missense probably damaging 1.00
R7830:Prune2 UTSW 19 17122674 missense probably benign 0.21
R7872:Prune2 UTSW 19 17119434 missense probably benign 0.05
R7881:Prune2 UTSW 19 17123029 missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17178859 missense probably damaging 0.99
R7969:Prune2 UTSW 19 17201670 missense probably damaging 0.98
R8092:Prune2 UTSW 19 17119993 missense probably damaging 1.00
R8110:Prune2 UTSW 19 17120719 missense probably benign 0.22
R8115:Prune2 UTSW 19 17123924 missense probably benign 0.02
R8129:Prune2 UTSW 19 17118836 missense probably benign 0.01
R8169:Prune2 UTSW 19 17125091 missense probably benign 0.10
R8171:Prune2 UTSW 19 17120518 missense probably damaging 1.00
R8176:Prune2 UTSW 19 17118292 missense probably damaging 1.00
R8200:Prune2 UTSW 19 17124973 missense probably benign 0.01
R8217:Prune2 UTSW 19 17120116 missense probably benign 0.01
R8258:Prune2 UTSW 19 17212308 missense unknown
R8259:Prune2 UTSW 19 17212308 missense unknown
R8289:Prune2 UTSW 19 17123009 missense probably benign 0.43
R8329:Prune2 UTSW 19 17121265 missense probably benign 0.02
R8342:Prune2 UTSW 19 17125663 missense probably benign 0.01
R8558:Prune2 UTSW 19 17122238 missense probably damaging 0.98
R8732:Prune2 UTSW 19 17120405 missense probably damaging 1.00
R8743:Prune2 UTSW 19 17119556 missense probably benign 0.22
R8769:Prune2 UTSW 19 17123078 missense probably damaging 0.96
R8862:Prune2 UTSW 19 17120146 missense probably benign 0.04
R8936:Prune2 UTSW 19 17121835 missense probably benign 0.24
R9040:Prune2 UTSW 19 17120627 missense probably damaging 1.00
R9084:Prune2 UTSW 19 17120377 missense probably damaging 1.00
R9224:Prune2 UTSW 19 17120029 missense probably damaging 1.00
R9275:Prune2 UTSW 19 17123780 missense probably benign 0.06
R9278:Prune2 UTSW 19 17123780 missense probably benign 0.06
R9290:Prune2 UTSW 19 17168327 missense probably benign 0.41
R9305:Prune2 UTSW 19 17120261 missense probably benign 0.14
R9317:Prune2 UTSW 19 17121670 missense probably benign 0.00
R9354:Prune2 UTSW 19 17122622 missense probably benign 0.43
R9373:Prune2 UTSW 19 17122138 missense probably benign
R9394:Prune2 UTSW 19 17003689 missense probably damaging 1.00
R9405:Prune2 UTSW 19 17216344 missense probably damaging 0.99
R9476:Prune2 UTSW 19 17119342 missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17122430 missense probably benign 0.00
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCCTTCTGTGACCTCC -3'
(R):5'- TGGGGCTGTAGGAGTCAAATCC -3'

Sequencing Primer
(F):5'- TTCTGTGACCTCCGACCAGG -3'
(R):5'- TCAAATCCTGGGAGAAGGCTATG -3'
Posted On 2022-03-25