Mutagenetix > Incidental Mutation

Incidental Mutation 'R9274:Col6a3'

703130

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90694582-90771710 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90707020 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 2638 (Y2638F)

Ref Sequence

ENSEMBL: ENSMUSP00000057131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000188587]

AlphaFold

no structure available at present

PDB Structure

Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]

Predicted Effect

unknown
Transcript: ENSMUST00000056925
AA Change: Y2638F

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: Y2638F

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000097653
AA Change: Y2031F

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: Y2031F

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000188587
AA Change: Y2031F

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: Y2031F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actc1	A	T	2: 113,879,752 (GRCm39)	S236T	probably benign	Het
Adam30	A	G	3: 98,069,267 (GRCm39)	T239A	probably benign	Het
Aoc1l2	T	C	6: 48,907,341 (GRCm39)	F114L	possibly damaging	Het
Ascl2	G	A	7: 142,521,753 (GRCm39)	R232C	probably damaging	Het
Atp10a	C	A	7: 58,478,369 (GRCm39)	Q1471K	probably benign	Het
Avl9	T	A	6: 56,720,346 (GRCm39)	D461E	probably damaging	Het
Baiap3	T	A	17: 25,463,354 (GRCm39)	Y983F	probably damaging	Het
C1rl	A	G	6: 124,485,483 (GRCm39)	S285G	probably benign	Het
Cacna1i	G	A	15: 80,254,354 (GRCm39)	V772M	probably damaging	Het
Ccser2	T	A	14: 36,660,737 (GRCm39)	D472V	possibly damaging	Het
Cd244a	T	G	1: 171,401,928 (GRCm39)	V218G	probably benign	Het
Cdhr1	T	C	14: 36,802,564 (GRCm39)	K633R	probably benign	Het
Col14a1	A	G	15: 55,381,671 (GRCm39)	Q1748R	probably damaging	Het
Crnkl1	A	T	2: 145,765,836 (GRCm39)	F411L	probably damaging	Het
Crp	T	A	1: 172,526,072 (GRCm39)	F52L	possibly damaging	Het
Dnah12	A	G	14: 26,537,374 (GRCm39)	N2208D	probably benign	Het
Exd2	T	C	12: 80,539,674 (GRCm39)		probably null	Het
F13a1	A	T	13: 37,052,761 (GRCm39)	I726N	probably damaging	Het
Fmo6	G	A	1: 162,747,921 (GRCm39)	T381I	probably benign	Het
Gdpd5	T	C	7: 99,107,989 (GRCm39)	L522P	probably damaging	Het
Gm12790	T	A	4: 101,824,743 (GRCm39)	D175V	possibly damaging	Het
Gm3543	T	C	14: 41,802,125 (GRCm39)	R120G	probably damaging	Het
Gpatch2	T	A	1: 186,963,029 (GRCm39)	D273E	probably damaging	Het
Hlcs	A	G	16: 94,088,785 (GRCm39)	S66P	possibly damaging	Het
Hmcn1	T	C	1: 150,506,046 (GRCm39)	T3827A	probably benign	Het
Ism2	G	A	12: 87,331,827 (GRCm39)	Q237*	probably null	Het
Jph2	G	A	2: 163,239,547 (GRCm39)		probably benign	Het
Kcnb2	A	G	1: 15,781,723 (GRCm39)	Q865R	probably benign	Het
Kcnh6	C	G	11: 105,924,860 (GRCm39)	H941Q	possibly damaging	Het
Kcnk9	A	G	15: 72,384,224 (GRCm39)	V318A	unknown	Het
Lemd3	G	A	10: 120,814,717 (GRCm39)	A172V	possibly damaging	Het
Lifr	G	T	15: 7,217,591 (GRCm39)	A840S	probably damaging	Het
Lnpep	T	C	17: 17,758,837 (GRCm39)	T836A	probably benign	Het
Mapk13	A	G	17: 28,988,490 (GRCm39)	Y36C	probably damaging	Het
Mdm2	G	A	10: 117,541,081 (GRCm39)		probably benign	Het
Msmb	T	C	14: 31,870,130 (GRCm39)	M34T	probably benign	Het
Myo5a	A	G	9: 75,097,279 (GRCm39)	N1319S	possibly damaging	Het
Myot	T	A	18: 44,479,265 (GRCm39)	V334E	probably damaging	Het
Nalcn	A	G	14: 123,753,068 (GRCm39)	I306T	probably damaging	Het
Nicn1	C	T	9: 108,171,708 (GRCm39)	R163C	possibly damaging	Het
Nphp4	T	C	4: 152,640,056 (GRCm39)	Y981H	probably benign	Het
Nphs2	G	A	1: 156,144,416 (GRCm39)	R140Q	probably damaging	Het
Nsa2	C	T	13: 97,272,170 (GRCm39)	R17H	probably benign	Het
Nup98	C	A	7: 101,788,037 (GRCm39)	R1011L	probably benign	Het
Obox6	T	C	7: 15,567,766 (GRCm39)	H227R	possibly damaging	Het
Or10ak14	G	A	4: 118,610,883 (GRCm39)	A286V	probably benign	Het
Or1j14	T	C	2: 36,417,559 (GRCm39)	I45T	probably damaging	Het
Or4c1	A	C	2: 89,133,513 (GRCm39)	L141R	probably damaging	Het
P2rx2	C	T	5: 110,489,709 (GRCm39)	G202D	probably damaging	Het
Pcdh12	A	G	18: 38,415,950 (GRCm39)	W392R	probably damaging	Het
Plxna2	G	A	1: 194,471,136 (GRCm39)	G969D	probably damaging	Het
Prg4	T	C	1: 150,331,924 (GRCm39)	T250A	possibly damaging	Het
Rad54l	G	T	4: 115,967,667 (GRCm39)	P205Q	probably damaging	Het
Ralgapb	A	G	2: 158,278,539 (GRCm39)	I334M	probably damaging	Het
Ric3	C	T	7: 108,647,212 (GRCm39)	D204N	probably damaging	Het
Rnf10	A	T	5: 115,385,322 (GRCm39)	Y557*	probably null	Het
Ruvbl1	A	G	6: 88,474,334 (GRCm39)	I446V	probably benign	Het
Serinc3	A	T	2: 163,468,371 (GRCm39)	V361D	probably damaging	Het
Slc4a1	C	A	11: 102,242,047 (GRCm39)	V864L	probably benign	Het
Slf1	C	A	13: 77,191,669 (GRCm39)	*1055L	probably null	Het
Stk25	T	C	1: 93,552,806 (GRCm39)	S328G	probably benign	Het
Stpg1	T	C	4: 135,252,782 (GRCm39)	F178L	possibly damaging	Het
Tmem25	C	T	9: 44,706,336 (GRCm39)	R345H	probably benign	Het
Tssk1	A	T	16: 17,712,724 (GRCm39)	I170L	probably benign	Het
Tubg1	A	G	11: 101,017,241 (GRCm39)		probably benign	Het
Uchl3	A	G	14: 101,903,240 (GRCm39)	D33G	probably damaging	Het
Vmn1r152	A	T	7: 22,223,056 (GRCm39)	H222L	probably benign	Het
Zfp975	C	T	7: 42,312,299 (GRCm39)	V105I	probably benign	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90,755,977 (GRCm39)	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90,709,748 (GRCm39)	missense	unknown
IGL00541:Col6a3	APN	1	90,729,864 (GRCm39)	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90,730,054 (GRCm39)	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90,731,655 (GRCm39)	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90,735,232 (GRCm39)	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90,730,236 (GRCm39)	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90,706,884 (GRCm39)	missense	unknown
IGL01827:Col6a3	APN	1	90,730,041 (GRCm39)	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90,724,293 (GRCm39)	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90,700,770 (GRCm39)	missense	unknown
IGL01900:Col6a3	APN	1	90,722,732 (GRCm39)	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90,729,958 (GRCm39)	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90,709,858 (GRCm39)	splice site	probably benign
IGL02115:Col6a3	APN	1	90,735,373 (GRCm39)	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90,709,482 (GRCm39)	missense	unknown
IGL02313:Col6a3	APN	1	90,739,328 (GRCm39)	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90,706,919 (GRCm39)	missense	unknown
IGL02821:Col6a3	APN	1	90,731,600 (GRCm39)	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90,724,281 (GRCm39)	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90,739,242 (GRCm39)	nonsense	probably null
IGL03129:Col6a3	APN	1	90,749,584 (GRCm39)	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90,731,615 (GRCm39)	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90,755,588 (GRCm39)	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90,737,898 (GRCm39)	missense	probably damaging	1.00
bailey	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
barnum	UTSW	1	90,706,874 (GRCm39)	missense	unknown
Boneless	UTSW	1	90,706,781 (GRCm39)	missense	unknown
Noodloid	UTSW	1	90,707,011 (GRCm39)	missense	unknown
randolf	UTSW	1	90,715,673 (GRCm39)	missense	unknown
stringy	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
wonder	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90,737,970 (GRCm39)	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90,706,516 (GRCm39)	missense	unknown
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90,725,883 (GRCm39)	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90,741,273 (GRCm39)	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90,725,895 (GRCm39)	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90,735,426 (GRCm39)	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90,755,771 (GRCm39)	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R0512:Col6a3	UTSW	1	90,749,520 (GRCm39)	intron	probably benign
R0564:Col6a3	UTSW	1	90,735,456 (GRCm39)	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90,735,808 (GRCm39)	splice site	probably null
R0667:Col6a3	UTSW	1	90,755,823 (GRCm39)	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90,706,703 (GRCm39)	missense	unknown
R0736:Col6a3	UTSW	1	90,731,811 (GRCm39)	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90,756,020 (GRCm39)	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90,730,375 (GRCm39)	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90,722,047 (GRCm39)	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1225:Col6a3	UTSW	1	90,739,238 (GRCm39)	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90,696,069 (GRCm39)	missense	unknown
R1387:Col6a3	UTSW	1	90,750,138 (GRCm39)	intron	probably benign
R1437:Col6a3	UTSW	1	90,729,098 (GRCm39)	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1677:Col6a3	UTSW	1	90,749,583 (GRCm39)	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90,701,224 (GRCm39)	missense	unknown
R1711:Col6a3	UTSW	1	90,757,935 (GRCm39)	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90,724,296 (GRCm39)	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90,706,781 (GRCm39)	missense	unknown
R1738:Col6a3	UTSW	1	90,744,083 (GRCm39)	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90,741,516 (GRCm39)	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90,755,671 (GRCm39)	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90,757,936 (GRCm39)	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90,739,421 (GRCm39)	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90,750,081 (GRCm39)	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90,731,897 (GRCm39)	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90,709,733 (GRCm39)	missense	unknown
R2121:Col6a3	UTSW	1	90,738,087 (GRCm39)	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90,731,467 (GRCm39)	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90,741,080 (GRCm39)	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90,731,435 (GRCm39)	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90,703,321 (GRCm39)	missense	unknown
R3052:Col6a3	UTSW	1	90,729,852 (GRCm39)	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90,707,803 (GRCm39)	missense	unknown
R4007:Col6a3	UTSW	1	90,730,291 (GRCm39)	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90,749,605 (GRCm39)	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90,729,105 (GRCm39)	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90,714,361 (GRCm39)	missense	unknown
R4297:Col6a3	UTSW	1	90,739,100 (GRCm39)	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90,709,626 (GRCm39)	missense	unknown
R4683:Col6a3	UTSW	1	90,701,179 (GRCm39)	missense	unknown
R4788:Col6a3	UTSW	1	90,700,672 (GRCm39)	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90,707,011 (GRCm39)	missense	unknown
R4899:Col6a3	UTSW	1	90,730,149 (GRCm39)	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90,729,164 (GRCm39)	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90,735,246 (GRCm39)	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90,731,940 (GRCm39)	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90,706,565 (GRCm39)	missense	unknown
R5057:Col6a3	UTSW	1	90,743,852 (GRCm39)	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90,707,074 (GRCm39)	missense	unknown
R5105:Col6a3	UTSW	1	90,725,862 (GRCm39)	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90,696,067 (GRCm39)	missense	unknown
R5166:Col6a3	UTSW	1	90,738,330 (GRCm39)	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90,701,361 (GRCm39)	nonsense	probably null
R5196:Col6a3	UTSW	1	90,744,260 (GRCm39)	splice site	probably null
R5230:Col6a3	UTSW	1	90,716,776 (GRCm39)	missense	unknown
R5268:Col6a3	UTSW	1	90,712,965 (GRCm39)	missense	unknown
R5381:Col6a3	UTSW	1	90,703,334 (GRCm39)	missense	unknown
R5392:Col6a3	UTSW	1	90,729,017 (GRCm39)	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90,709,761 (GRCm39)	nonsense	probably null
R5571:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R5665:Col6a3	UTSW	1	90,755,602 (GRCm39)	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90,729,921 (GRCm39)	splice site	probably null
R5914:Col6a3	UTSW	1	90,703,922 (GRCm39)	missense	unknown
R5955:Col6a3	UTSW	1	90,739,163 (GRCm39)	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90,749,571 (GRCm39)	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90,696,105 (GRCm39)	missense	unknown
R6010:Col6a3	UTSW	1	90,701,219 (GRCm39)	missense	unknown
R6025:Col6a3	UTSW	1	90,755,824 (GRCm39)	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90,741,475 (GRCm39)	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90,701,387 (GRCm39)	missense	unknown
R6181:Col6a3	UTSW	1	90,744,096 (GRCm39)	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90,750,063 (GRCm39)	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90,749,955 (GRCm39)	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90,738,285 (GRCm39)	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90,709,534 (GRCm39)	missense	unknown
R6484:Col6a3	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6703:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6703:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6724:Col6a3	UTSW	1	90,706,874 (GRCm39)	missense	unknown
R6746:Col6a3	UTSW	1	90,706,767 (GRCm39)	missense	unknown
R6797:Col6a3	UTSW	1	90,731,810 (GRCm39)	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90,722,731 (GRCm39)	splice site	probably null
R6903:Col6a3	UTSW	1	90,721,929 (GRCm39)	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90,743,724 (GRCm39)	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90,735,192 (GRCm39)	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90,755,759 (GRCm39)	nonsense	probably null
R7182:Col6a3	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
R7294:Col6a3	UTSW	1	90,756,005 (GRCm39)	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90,755,708 (GRCm39)	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90,750,013 (GRCm39)	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90,755,855 (GRCm39)	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90,703,463 (GRCm39)	missense	unknown
R7575:Col6a3	UTSW	1	90,738,321 (GRCm39)	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90,709,467 (GRCm39)	missense	unknown
R7679:Col6a3	UTSW	1	90,739,473 (GRCm39)	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90,724,268 (GRCm39)	nonsense	probably null
R7855:Col6a3	UTSW	1	90,738,343 (GRCm39)	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R8003:Col6a3	UTSW	1	90,703,455 (GRCm39)	missense	unknown
R8007:Col6a3	UTSW	1	90,705,179 (GRCm39)	missense	unknown
R8098:Col6a3	UTSW	1	90,731,383 (GRCm39)	missense	probably benign
R8312:Col6a3	UTSW	1	90,741,412 (GRCm39)	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90,729,935 (GRCm39)	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90,727,747 (GRCm39)	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90,696,171 (GRCm39)	missense	unknown
R8857:Col6a3	UTSW	1	90,703,485 (GRCm39)	missense	unknown
R8867:Col6a3	UTSW	1	90,715,673 (GRCm39)	missense	unknown
R8887:Col6a3	UTSW	1	90,755,948 (GRCm39)	missense	probably benign
R9011:Col6a3	UTSW	1	90,710,057 (GRCm39)	splice site	probably benign
R9049:Col6a3	UTSW	1	90,707,066 (GRCm39)	missense	unknown
R9142:Col6a3	UTSW	1	90,706,566 (GRCm39)	missense	unknown
R9155:Col6a3	UTSW	1	90,738,301 (GRCm39)	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9258:Col6a3	UTSW	1	90,700,703 (GRCm39)	missense	unknown
R9276:Col6a3	UTSW	1	90,735,403 (GRCm39)	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90,738,979 (GRCm39)	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90,709,523 (GRCm39)	missense	unknown
R9377:Col6a3	UTSW	1	90,743,961 (GRCm39)	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90,731,585 (GRCm39)	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90,744,155 (GRCm39)	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90,707,068 (GRCm39)	missense	unknown
R9441:Col6a3	UTSW	1	90,705,249 (GRCm39)	nonsense	probably null
R9477:Col6a3	UTSW	1	90,706,621 (GRCm39)	missense	unknown
R9498:Col6a3	UTSW	1	90,713,650 (GRCm39)	nonsense	probably null
R9528:Col6a3	UTSW	1	90,731,789 (GRCm39)	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90,731,497 (GRCm39)	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90,738,984 (GRCm39)	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90,738,282 (GRCm39)	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90,731,359 (GRCm39)	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90,731,627 (GRCm39)	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90,739,251 (GRCm39)	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90,739,450 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGAAATCCAACAGCTTTTCCTTG -3'
(R):5'- CAGAAAATTGGGACACTGCTGG -3'

Sequencing Primer
(F):5'- GGCACCATAGTCTGTCAGTGAG -3'
(R):5'- ACACTGCTGGGACCACATG -3'

Posted On

2022-03-25