Incidental Mutation 'R9274:1600015I10Rik'
ID 703155
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9274 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48930407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 114 (F114L)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect possibly damaging
Transcript: ENSMUST00000031837
AA Change: F114L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: F114L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actc1 A T 2: 114,049,271 S236T probably benign Het
Adam30 A G 3: 98,161,951 T239A probably benign Het
Ascl2 G A 7: 142,968,016 R232C probably damaging Het
Atp10a C A 7: 58,828,621 Q1471K probably benign Het
Avl9 T A 6: 56,743,361 D461E probably damaging Het
Baiap3 T A 17: 25,244,380 Y983F probably damaging Het
C1rl A G 6: 124,508,524 S285G probably benign Het
Cacna1i G A 15: 80,370,153 V772M probably damaging Het
Ccser2 T A 14: 36,938,780 D472V possibly damaging Het
Cd244 T G 1: 171,574,360 V218G probably benign Het
Cdhr1 T C 14: 37,080,607 K633R probably benign Het
Col14a1 A G 15: 55,518,275 Q1748R probably damaging Het
Col6a3 T A 1: 90,779,298 Y2638F unknown Het
Crnkl1 A T 2: 145,923,916 F411L probably damaging Het
Crp T A 1: 172,698,505 F52L possibly damaging Het
Dnah12 A G 14: 26,815,417 N2208D probably benign Het
Exd2 T C 12: 80,492,900 probably null Het
F13a1 A T 13: 36,868,787 I726N probably damaging Het
Fmo6 G A 1: 162,920,352 T381I probably benign Het
Gdpd5 T C 7: 99,458,782 L522P probably damaging Het
Gm12790 T A 4: 101,967,546 D175V possibly damaging Het
Gm3543 T C 14: 41,980,168 R120G probably damaging Het
Gpatch2 T A 1: 187,230,832 D273E probably damaging Het
Hlcs A G 16: 94,287,926 S66P possibly damaging Het
Hmcn1 T C 1: 150,630,295 T3827A probably benign Het
Ism2 G A 12: 87,285,053 Q237* probably null Het
Jph2 G A 2: 163,397,627 probably benign Het
Kcnb2 A G 1: 15,711,499 Q865R probably benign Het
Kcnh6 C G 11: 106,034,034 H941Q possibly damaging Het
Kcnk9 A G 15: 72,512,375 V318A unknown Het
Lemd3 G A 10: 120,978,812 A172V possibly damaging Het
Lifr G T 15: 7,188,110 A840S probably damaging Het
Lnpep T C 17: 17,538,575 T836A probably benign Het
Mapk13 A G 17: 28,769,516 Y36C probably damaging Het
Mdm2 G A 10: 117,705,176 probably benign Het
Msmb T C 14: 32,148,173 M34T probably benign Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Myot T A 18: 44,346,198 V334E probably damaging Het
Nalcn A G 14: 123,515,656 I306T probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp4 T C 4: 152,555,599 Y981H probably benign Het
Nphs2 G A 1: 156,316,846 R140Q probably damaging Het
Nsa2 C T 13: 97,135,662 R17H probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Obox6 T C 7: 15,833,841 H227R possibly damaging Het
Olfr1231 A C 2: 89,303,169 L141R probably damaging Het
Olfr1338 G A 4: 118,753,686 A286V probably benign Het
Olfr342 T C 2: 36,527,547 I45T probably damaging Het
P2rx2 C T 5: 110,341,843 G202D probably damaging Het
Pcdh12 A G 18: 38,282,897 W392R probably damaging Het
Plxna2 G A 1: 194,788,828 G969D probably damaging Het
Prg4 T C 1: 150,456,173 T250A possibly damaging Het
Rad54l G T 4: 116,110,470 P205Q probably damaging Het
Ralgapb A G 2: 158,436,619 I334M probably damaging Het
Ric3 C T 7: 109,048,005 D204N probably damaging Het
Rnf10 A T 5: 115,247,263 Y557* probably null Het
Ruvbl1 A G 6: 88,497,352 I446V probably benign Het
Serinc3 A T 2: 163,626,451 V361D probably damaging Het
Slc4a1 C A 11: 102,351,221 V864L probably benign Het
Slf1 C A 13: 77,043,550 *1055L probably null Het
Stk25 T C 1: 93,625,084 S328G probably benign Het
Stpg1 T C 4: 135,525,471 F178L possibly damaging Het
Tmem25 C T 9: 44,795,039 R345H probably benign Het
Tssk1 A T 16: 17,894,860 I170L probably benign Het
Uchl3 A G 14: 101,665,804 D33G probably damaging Het
Vmn1r152 A T 7: 22,523,631 H222L probably benign Het
Zeb1 GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 18: 5,772,840 probably benign Het
Zfp975 C T 7: 42,662,875 V105I probably benign Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
R9562:1600015I10Rik UTSW 6 48930975 missense not run
R9565:1600015I10Rik UTSW 6 48930975 missense not run
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GTGCAGAACTTCCTGATGGAC -3'
(R):5'- TCCTCAACACGTTCTTTTAGTGAG -3'

Sequencing Primer
(F):5'- CTTCCTGATGGACAAAAAGGAGCTG -3'
(R):5'- ATGCAGAGACTTGGTGGCCTC -3'
Posted On 2022-03-25