Incidental Mutation 'R9274:Myo5a'
ID 703168
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R9274 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 75071015-75223688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75189997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1319 (N1319S)
Ref Sequence ENSEMBL: ENSMUSP00000120444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000129281] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably benign
Transcript: ENSMUST00000123128
AA Change: N1319S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: N1319S

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129281
AA Change: N109S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118881
Gene: ENSMUSG00000034593
AA Change: N109S

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 129 181 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114803
Gene: ENSMUSG00000034593
AA Change: N75S

DomainStartEndE-ValueType
coiled coil region 95 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136604
Predicted Effect possibly damaging
Transcript: ENSMUST00000136731
AA Change: N1319S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: N1319S

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143355
Predicted Effect probably benign
Transcript: ENSMUST00000148144
AA Change: N76S

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: N76S

DomainStartEndE-ValueType
coiled coil region 71 175 N/A INTRINSIC
Blast:DIL 275 305 4e-13 BLAST
Blast:DIL 330 355 5e-6 BLAST
DIL 417 522 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153404
Predicted Effect probably benign
Transcript: ENSMUST00000155282
AA Change: N1319S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: N1319S

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,407 F114L possibly damaging Het
Actc1 A T 2: 114,049,271 S236T probably benign Het
Adam30 A G 3: 98,161,951 T239A probably benign Het
Ascl2 G A 7: 142,968,016 R232C probably damaging Het
Atp10a C A 7: 58,828,621 Q1471K probably benign Het
Avl9 T A 6: 56,743,361 D461E probably damaging Het
Baiap3 T A 17: 25,244,380 Y983F probably damaging Het
C1rl A G 6: 124,508,524 S285G probably benign Het
Cacna1i G A 15: 80,370,153 V772M probably damaging Het
Ccser2 T A 14: 36,938,780 D472V possibly damaging Het
Cd244 T G 1: 171,574,360 V218G probably benign Het
Cdhr1 T C 14: 37,080,607 K633R probably benign Het
Col14a1 A G 15: 55,518,275 Q1748R probably damaging Het
Col6a3 T A 1: 90,779,298 Y2638F unknown Het
Crnkl1 A T 2: 145,923,916 F411L probably damaging Het
Crp T A 1: 172,698,505 F52L possibly damaging Het
Dnah12 A G 14: 26,815,417 N2208D probably benign Het
Exd2 T C 12: 80,492,900 probably null Het
F13a1 A T 13: 36,868,787 I726N probably damaging Het
Fmo6 G A 1: 162,920,352 T381I probably benign Het
Gdpd5 T C 7: 99,458,782 L522P probably damaging Het
Gm12790 T A 4: 101,967,546 D175V possibly damaging Het
Gm3543 T C 14: 41,980,168 R120G probably damaging Het
Gpatch2 T A 1: 187,230,832 D273E probably damaging Het
Hlcs A G 16: 94,287,926 S66P possibly damaging Het
Hmcn1 T C 1: 150,630,295 T3827A probably benign Het
Ism2 G A 12: 87,285,053 Q237* probably null Het
Jph2 G A 2: 163,397,627 probably benign Het
Kcnb2 A G 1: 15,711,499 Q865R probably benign Het
Kcnh6 C G 11: 106,034,034 H941Q possibly damaging Het
Kcnk9 A G 15: 72,512,375 V318A unknown Het
Lemd3 G A 10: 120,978,812 A172V possibly damaging Het
Lifr G T 15: 7,188,110 A840S probably damaging Het
Lnpep T C 17: 17,538,575 T836A probably benign Het
Mapk13 A G 17: 28,769,516 Y36C probably damaging Het
Mdm2 G A 10: 117,705,176 probably benign Het
Msmb T C 14: 32,148,173 M34T probably benign Het
Myot T A 18: 44,346,198 V334E probably damaging Het
Nalcn A G 14: 123,515,656 I306T probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp4 T C 4: 152,555,599 Y981H probably benign Het
Nphs2 G A 1: 156,316,846 R140Q probably damaging Het
Nsa2 C T 13: 97,135,662 R17H probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Obox6 T C 7: 15,833,841 H227R possibly damaging Het
Olfr1231 A C 2: 89,303,169 L141R probably damaging Het
Olfr1338 G A 4: 118,753,686 A286V probably benign Het
Olfr342 T C 2: 36,527,547 I45T probably damaging Het
P2rx2 C T 5: 110,341,843 G202D probably damaging Het
Pcdh12 A G 18: 38,282,897 W392R probably damaging Het
Plxna2 G A 1: 194,788,828 G969D probably damaging Het
Prg4 T C 1: 150,456,173 T250A possibly damaging Het
Rad54l G T 4: 116,110,470 P205Q probably damaging Het
Ralgapb A G 2: 158,436,619 I334M probably damaging Het
Ric3 C T 7: 109,048,005 D204N probably damaging Het
Rnf10 A T 5: 115,247,263 Y557* probably null Het
Ruvbl1 A G 6: 88,497,352 I446V probably benign Het
Serinc3 A T 2: 163,626,451 V361D probably damaging Het
Slc4a1 C A 11: 102,351,221 V864L probably benign Het
Slf1 C A 13: 77,043,550 *1055L probably null Het
Stk25 T C 1: 93,625,084 S328G probably benign Het
Stpg1 T C 4: 135,525,471 F178L possibly damaging Het
Tmem25 C T 9: 44,795,039 R345H probably benign Het
Tssk1 A T 16: 17,894,860 I170L probably benign Het
Uchl3 A G 14: 101,665,804 D33G probably damaging Het
Vmn1r152 A T 7: 22,523,631 H222L probably benign Het
Zeb1 GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 18: 5,772,840 probably benign Het
Zfp975 C T 7: 42,662,875 V105I probably benign Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 splice site probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 splice site probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
R7620:Myo5a UTSW 9 75164136 missense probably benign 0.41
R7719:Myo5a UTSW 9 75144084 missense probably benign 0.01
R7810:Myo5a UTSW 9 75160465 missense probably benign 0.09
R7810:Myo5a UTSW 9 75169010 missense probably benign
R7866:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R7939:Myo5a UTSW 9 75189900 missense
R8050:Myo5a UTSW 9 75181946 missense probably damaging 0.99
R8061:Myo5a UTSW 9 75122957 nonsense probably null
R8326:Myo5a UTSW 9 75217989 missense probably damaging 0.98
R8529:Myo5a UTSW 9 75212872 missense probably benign 0.02
R8824:Myo5a UTSW 9 75167046 missense probably damaging 1.00
R8858:Myo5a UTSW 9 75184683 missense probably damaging 0.99
R9040:Myo5a UTSW 9 75174059 missense probably benign 0.07
R9092:Myo5a UTSW 9 75147132 critical splice donor site probably null
R9249:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75180030 missense probably benign 0.37
R9366:Myo5a UTSW 9 75217518 missense probably damaging 0.98
R9410:Myo5a UTSW 9 75116214 missense probably damaging 0.98
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75186036 missense
Predicted Primers PCR Primer
(F):5'- GAATGAACCTTTTGGGGATGC -3'
(R):5'- ACACCAAGTGTCACTATTTACCTG -3'

Sequencing Primer
(F):5'- AGATTGAACTCTGGTCATCAGGC -3'
(R):5'- TCCAGTGAGTTCCTGCA -3'
Posted On 2022-03-25