Incidental Mutation 'R9274:Cacna1i'
ID 703189
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9274 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80254354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 772 (V772M)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: V772M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: V772M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: V772M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: V772M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actc1 A T 2: 113,879,752 (GRCm39) S236T probably benign Het
Adam30 A G 3: 98,069,267 (GRCm39) T239A probably benign Het
Aoc1l2 T C 6: 48,907,341 (GRCm39) F114L possibly damaging Het
Ascl2 G A 7: 142,521,753 (GRCm39) R232C probably damaging Het
Atp10a C A 7: 58,478,369 (GRCm39) Q1471K probably benign Het
Avl9 T A 6: 56,720,346 (GRCm39) D461E probably damaging Het
Baiap3 T A 17: 25,463,354 (GRCm39) Y983F probably damaging Het
C1rl A G 6: 124,485,483 (GRCm39) S285G probably benign Het
Ccser2 T A 14: 36,660,737 (GRCm39) D472V possibly damaging Het
Cd244a T G 1: 171,401,928 (GRCm39) V218G probably benign Het
Cdhr1 T C 14: 36,802,564 (GRCm39) K633R probably benign Het
Col14a1 A G 15: 55,381,671 (GRCm39) Q1748R probably damaging Het
Col6a3 T A 1: 90,707,020 (GRCm39) Y2638F unknown Het
Crnkl1 A T 2: 145,765,836 (GRCm39) F411L probably damaging Het
Crp T A 1: 172,526,072 (GRCm39) F52L possibly damaging Het
Dnah12 A G 14: 26,537,374 (GRCm39) N2208D probably benign Het
Exd2 T C 12: 80,539,674 (GRCm39) probably null Het
F13a1 A T 13: 37,052,761 (GRCm39) I726N probably damaging Het
Fmo6 G A 1: 162,747,921 (GRCm39) T381I probably benign Het
Gdpd5 T C 7: 99,107,989 (GRCm39) L522P probably damaging Het
Gm12790 T A 4: 101,824,743 (GRCm39) D175V possibly damaging Het
Gm3543 T C 14: 41,802,125 (GRCm39) R120G probably damaging Het
Gpatch2 T A 1: 186,963,029 (GRCm39) D273E probably damaging Het
Hlcs A G 16: 94,088,785 (GRCm39) S66P possibly damaging Het
Hmcn1 T C 1: 150,506,046 (GRCm39) T3827A probably benign Het
Ism2 G A 12: 87,331,827 (GRCm39) Q237* probably null Het
Jph2 G A 2: 163,239,547 (GRCm39) probably benign Het
Kcnb2 A G 1: 15,781,723 (GRCm39) Q865R probably benign Het
Kcnh6 C G 11: 105,924,860 (GRCm39) H941Q possibly damaging Het
Kcnk9 A G 15: 72,384,224 (GRCm39) V318A unknown Het
Lemd3 G A 10: 120,814,717 (GRCm39) A172V possibly damaging Het
Lifr G T 15: 7,217,591 (GRCm39) A840S probably damaging Het
Lnpep T C 17: 17,758,837 (GRCm39) T836A probably benign Het
Mapk13 A G 17: 28,988,490 (GRCm39) Y36C probably damaging Het
Mdm2 G A 10: 117,541,081 (GRCm39) probably benign Het
Msmb T C 14: 31,870,130 (GRCm39) M34T probably benign Het
Myo5a A G 9: 75,097,279 (GRCm39) N1319S possibly damaging Het
Myot T A 18: 44,479,265 (GRCm39) V334E probably damaging Het
Nalcn A G 14: 123,753,068 (GRCm39) I306T probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nphp4 T C 4: 152,640,056 (GRCm39) Y981H probably benign Het
Nphs2 G A 1: 156,144,416 (GRCm39) R140Q probably damaging Het
Nsa2 C T 13: 97,272,170 (GRCm39) R17H probably benign Het
Nup98 C A 7: 101,788,037 (GRCm39) R1011L probably benign Het
Obox6 T C 7: 15,567,766 (GRCm39) H227R possibly damaging Het
Or10ak14 G A 4: 118,610,883 (GRCm39) A286V probably benign Het
Or1j14 T C 2: 36,417,559 (GRCm39) I45T probably damaging Het
Or4c1 A C 2: 89,133,513 (GRCm39) L141R probably damaging Het
P2rx2 C T 5: 110,489,709 (GRCm39) G202D probably damaging Het
Pcdh12 A G 18: 38,415,950 (GRCm39) W392R probably damaging Het
Plxna2 G A 1: 194,471,136 (GRCm39) G969D probably damaging Het
Prg4 T C 1: 150,331,924 (GRCm39) T250A possibly damaging Het
Rad54l G T 4: 115,967,667 (GRCm39) P205Q probably damaging Het
Ralgapb A G 2: 158,278,539 (GRCm39) I334M probably damaging Het
Ric3 C T 7: 108,647,212 (GRCm39) D204N probably damaging Het
Rnf10 A T 5: 115,385,322 (GRCm39) Y557* probably null Het
Ruvbl1 A G 6: 88,474,334 (GRCm39) I446V probably benign Het
Serinc3 A T 2: 163,468,371 (GRCm39) V361D probably damaging Het
Slc4a1 C A 11: 102,242,047 (GRCm39) V864L probably benign Het
Slf1 C A 13: 77,191,669 (GRCm39) *1055L probably null Het
Stk25 T C 1: 93,552,806 (GRCm39) S328G probably benign Het
Stpg1 T C 4: 135,252,782 (GRCm39) F178L possibly damaging Het
Tmem25 C T 9: 44,706,336 (GRCm39) R345H probably benign Het
Tssk1 A T 16: 17,712,724 (GRCm39) I170L probably benign Het
Tubg1 A G 11: 101,017,241 (GRCm39) probably benign Het
Uchl3 A G 14: 101,903,240 (GRCm39) D33G probably damaging Het
Vmn1r152 A T 7: 22,223,056 (GRCm39) H222L probably benign Het
Zfp975 C T 7: 42,312,299 (GRCm39) V105I probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCCCTCTATTTAACATGGACTTGAG -3'
(R):5'- AACGTTCCAGTCCTCCTGAG -3'

Sequencing Primer
(F):5'- AACATGGACTTGAGATTTCCCTC -3'
(R):5'- TTCCAGTCCTCCTGAGTGAGG -3'
Posted On 2022-03-25