Incidental Mutation 'R9275:Trim34a'
ID 703223
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Name tripartite motif-containing 34A
Synonyms Trim34-1, Trim34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9275 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104244457-104262234 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104260994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 334 (N334K)
Ref Sequence ENSEMBL: ENSMUSP00000055058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051795
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060315
AA Change: N334K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: N334K

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098179
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106848
AA Change: N334K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: N334K

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106849
AA Change: N334K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: N334K

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,464,282 Y249H probably damaging Het
AF067063 T C 13: 119,828,457 S68G possibly damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Akap11 C A 14: 78,513,709 V413F Het
Ank3 T C 10: 69,986,832 S444P probably damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arhgap10 A G 8: 77,411,036 S309P probably damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Atp5a1 C T 18: 77,781,297 T457I probably damaging Het
Bsn C T 9: 108,111,620 R2311H probably damaging Het
C1ra A G 6: 124,517,424 T277A probably benign Het
Celsr3 C G 9: 108,838,490 L2124V probably benign Het
Cenpv T C 11: 62,525,163 *253W probably null Het
Cfap54 A T 10: 93,039,186 V479E possibly damaging Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Cpne2 T C 8: 94,555,015 I226T possibly damaging Het
Cyp2c67 C T 19: 39,609,255 R433Q probably damaging Het
Dagla A G 19: 10,254,856 Y489H probably damaging Het
Dennd4a C A 9: 64,842,624 P166T probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Enpp2 C T 15: 54,850,088 R658Q probably benign Het
Gm10521 G A 1: 171,896,463 V114I unknown Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
H2-T24 T A 17: 36,017,384 E69V probably damaging Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hsf2bp C T 17: 31,987,362 W265* probably null Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Kcng2 T C 18: 80,295,859 S405G possibly damaging Het
Leng9 T C 7: 4,148,448 T410A probably benign Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mlkl A G 8: 111,316,423 V364A probably benign Het
Mns1 T A 9: 72,449,225 F254Y probably benign Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Olfr1025-ps1 A G 2: 85,918,702 Y259C probably benign Het
Olfr111 T A 17: 37,530,928 M317K probably benign Het
Pde10a A G 17: 8,981,656 *797W probably null Het
Pirb T G 7: 3,716,860 H429P probably benign Het
Plbd1 A G 6: 136,617,288 L321P probably damaging Het
Pmfbp1 A G 8: 109,535,839 I722V probably benign Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Ptpn1 C T 2: 167,974,256 T230I probably damaging Het
Rhpn1 T C 15: 75,713,271 V519A possibly damaging Het
Rnf213 T C 11: 119,435,942 V1586A Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Scn1a T A 2: 66,299,682 Y243F probably damaging Het
Sdk1 A G 5: 141,956,198 T534A possibly damaging Het
Slc27a5 T C 7: 12,997,713 D117G probably damaging Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Smpd2 T C 10: 41,487,689 D289G probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Stard3 G A 11: 98,372,105 probably benign Het
Tcf19 A G 17: 35,515,002 V86A probably damaging Het
Tigit A T 16: 43,659,470 M154K probably benign Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttn A T 2: 76,907,874 M4153K unknown Het
Uchl3 A T 14: 101,668,527 probably null Het
Usp1 A G 4: 98,931,341 K347E probably damaging Het
Vmn1r73 T C 7: 11,756,552 M99T probably benign Het
Vmn2r20 A G 6: 123,385,435 W797R probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 splice site probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 splice site probably null
Gold_belt UTSW 7 104261064 nonsense probably null
PIT4472001:Trim34a UTSW 7 104247948 missense probably damaging 1.00
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 splice site probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R3685:Trim34a UTSW 7 104260126 splice site probably null
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5443:Trim34a UTSW 7 104260213 missense possibly damaging 0.80
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6147:Trim34a UTSW 7 104261191 missense probably damaging 0.99
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
R7971:Trim34a UTSW 7 104247818 missense probably damaging 0.98
R8060:Trim34a UTSW 7 104260976 missense probably damaging 1.00
R8278:Trim34a UTSW 7 104249416 missense probably damaging 0.99
R8356:Trim34a UTSW 7 104260971 missense probably damaging 0.99
R9563:Trim34a UTSW 7 104261121 nonsense probably null
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCAGTGTTGGCTTTTCACAG -3'
(R):5'- TTCGATCCATGCTGTAACCC -3'

Sequencing Primer
(F):5'- GGCTTTTCACAGTGTTTCACAAAC -3'
(R):5'- ATAACCCAGTAGCCATTCTGTG -3'
Posted On 2022-03-25