Incidental Mutation 'R9275:Mlkl'
ID 703227
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Name mixed lineage kinase domain-like
Synonyms 9130019I15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9275 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111311797-111338177 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111316423 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 364 (V364A)
Ref Sequence ENSEMBL: ENSMUSP00000055521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432]
AlphaFold Q9D2Y4
PDB Structure Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000056157
AA Change: V364A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: V364A

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120432
AA Change: V364A

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: V364A

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,464,282 Y249H probably damaging Het
AF067063 T C 13: 119,828,457 S68G possibly damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Akap11 C A 14: 78,513,709 V413F Het
Ank3 T C 10: 69,986,832 S444P probably damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arhgap10 A G 8: 77,411,036 S309P probably damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Atp5a1 C T 18: 77,781,297 T457I probably damaging Het
Bsn C T 9: 108,111,620 R2311H probably damaging Het
C1ra A G 6: 124,517,424 T277A probably benign Het
Celsr3 C G 9: 108,838,490 L2124V probably benign Het
Cenpv T C 11: 62,525,163 *253W probably null Het
Cfap54 A T 10: 93,039,186 V479E possibly damaging Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Cpne2 T C 8: 94,555,015 I226T possibly damaging Het
Cyp2c67 C T 19: 39,609,255 R433Q probably damaging Het
Dagla A G 19: 10,254,856 Y489H probably damaging Het
Dennd4a C A 9: 64,842,624 P166T probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Enpp2 C T 15: 54,850,088 R658Q probably benign Het
Gm10521 G A 1: 171,896,463 V114I unknown Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
H2-T24 T A 17: 36,017,384 E69V probably damaging Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hsf2bp C T 17: 31,987,362 W265* probably null Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Kcng2 T C 18: 80,295,859 S405G possibly damaging Het
Leng9 T C 7: 4,148,448 T410A probably benign Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mns1 T A 9: 72,449,225 F254Y probably benign Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Olfr1025-ps1 A G 2: 85,918,702 Y259C probably benign Het
Olfr111 T A 17: 37,530,928 M317K probably benign Het
Pde10a A G 17: 8,981,656 *797W probably null Het
Pirb T G 7: 3,716,860 H429P probably benign Het
Plbd1 A G 6: 136,617,288 L321P probably damaging Het
Pmfbp1 A G 8: 109,535,839 I722V probably benign Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Ptpn1 C T 2: 167,974,256 T230I probably damaging Het
Rhpn1 T C 15: 75,713,271 V519A possibly damaging Het
Rnf213 T C 11: 119,435,942 V1586A Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Scn1a T A 2: 66,299,682 Y243F probably damaging Het
Sdk1 A G 5: 141,956,198 T534A possibly damaging Het
Slc27a5 T C 7: 12,997,713 D117G probably damaging Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Smpd2 T C 10: 41,487,689 D289G probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Stard3 G A 11: 98,372,105 probably benign Het
Tcf19 A G 17: 35,515,002 V86A probably damaging Het
Tigit A T 16: 43,659,470 M154K probably benign Het
Trim34a T A 7: 104,260,994 N334K probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttn A T 2: 76,907,874 M4153K unknown Het
Uchl3 A T 14: 101,668,527 probably null Het
Usp1 A G 4: 98,931,341 K347E probably damaging Het
Vmn1r73 T C 7: 11,756,552 M99T probably benign Het
Vmn2r20 A G 6: 123,385,435 W797R probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
Ghoulish UTSW 8 111322748 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R7728:Mlkl UTSW 8 111333619 missense probably damaging 1.00
R8036:Mlkl UTSW 8 111333454 missense probably damaging 1.00
R8064:Mlkl UTSW 8 111312068 missense probably benign 0.38
R9088:Mlkl UTSW 8 111322733 missense
R9152:Mlkl UTSW 8 111319771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAATGTAGCCTGAACCTAC -3'
(R):5'- GGAGTATCATCCTCCCCAACTC -3'

Sequencing Primer
(F):5'- GTACTTCACCACCGACCTGAG -3'
(R):5'- AACTCTCCCTTCTACCCCTCCAC -3'
Posted On 2022-03-25